Incidental Mutation 'R2061:Slc35b1'
ID 316281
Institutional Source Beutler Lab
Gene Symbol Slc35b1
Ensembl Gene ENSMUSG00000020873
Gene Name solute carrier family 35, member B1
Synonyms Ugalt2
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 95275696-95282602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 95276718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 102 (F102V)
Ref Sequence ENSEMBL: ENSMUSP00000021243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021243] [ENSMUST00000037502] [ENSMUST00000131193] [ENSMUST00000146556] [ENSMUST00000232252]
AlphaFold P97858
Predicted Effect possibly damaging
Transcript: ENSMUST00000021243
AA Change: F102V

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021243
Gene: ENSMUSG00000020873
AA Change: F102V

DomainStartEndE-ValueType
Pfam:TPT 12 309 1.3e-14 PFAM
Pfam:UAA 13 313 2.1e-58 PFAM
Pfam:EamA 170 309 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037502
SMART Domains Protein: ENSMUSP00000049162
Gene: ENSMUSG00000038893

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
Pfam:FAM117 86 397 3.6e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131193
AA Change: F102V

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125307
Gene: ENSMUSG00000020873
AA Change: F102V

DomainStartEndE-ValueType
Pfam:UAA 14 91 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143090
Predicted Effect probably benign
Transcript: ENSMUST00000146556
AA Change: V64G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125597
Gene: ENSMUSG00000020873
AA Change: V64G

DomainStartEndE-ValueType
low complexity region 14 23 N/A INTRINSIC
Pfam:EmrE 38 149 3.9e-9 PFAM
Pfam:UAA 46 153 4.5e-30 PFAM
Pfam:EamA 63 146 1.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189860
Predicted Effect probably benign
Transcript: ENSMUST00000232252
AA Change: F66V

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.2589 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotide sugar transporter which is a member of solute carrier family 35. The transporters in this family are highly conserved hydrophobic proteins with multiple transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Col12a1 T A 9: 79,524,987 (GRCm39) I2725F possibly damaging Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,841,227 (GRCm39) D634E probably damaging Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Hivep1 A G 13: 42,313,600 (GRCm39) K1947E possibly damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Jmjd1c A T 10: 67,054,205 (GRCm39) E323D probably damaging Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pcsk5 T C 19: 17,432,236 (GRCm39) T1460A probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plch2 A T 4: 155,127,298 (GRCm39) probably benign Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Slc35b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc35b1 APN 11 95,279,910 (GRCm39) missense probably benign 0.01
IGL03151:Slc35b1 APN 11 95,281,212 (GRCm39) critical splice donor site probably null
R0026:Slc35b1 UTSW 11 95,281,468 (GRCm39) missense probably benign
R0026:Slc35b1 UTSW 11 95,281,468 (GRCm39) missense probably benign
R0125:Slc35b1 UTSW 11 95,277,353 (GRCm39) missense probably benign 0.01
R1331:Slc35b1 UTSW 11 95,276,689 (GRCm39) missense probably damaging 1.00
R2192:Slc35b1 UTSW 11 95,276,640 (GRCm39) missense probably damaging 1.00
R5283:Slc35b1 UTSW 11 95,275,814 (GRCm39) start gained probably benign
R5484:Slc35b1 UTSW 11 95,278,631 (GRCm39) missense probably damaging 1.00
R7620:Slc35b1 UTSW 11 95,278,691 (GRCm39) missense probably damaging 1.00
R8678:Slc35b1 UTSW 11 95,278,646 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCTCCTTTGGGTAAATGAGC -3'
(R):5'- TTCACAGCCATTGGTTTTACAG -3'

Sequencing Primer
(F):5'- GGGTAAATGAGCTCAGTAATCCTTCC -3'
(R):5'- ACAGCCATTGGTTTTACAGTCTGTAG -3'
Posted On 2015-05-15