Incidental Mutation 'R2061:Hectd1'
ID 316286
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene Name HECT domain E3 ubiquitin protein ligase 1
Synonyms A630086P08Rik, b2b327Clo, opm
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 51790505-51876319 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51841227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 634 (D634E)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
AlphaFold Q69ZR2
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: D634E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: D634E

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179265
AA Change: D635E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: D635E

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Col12a1 T A 9: 79,524,987 (GRCm39) I2725F possibly damaging Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Hivep1 A G 13: 42,313,600 (GRCm39) K1947E possibly damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Jmjd1c A T 10: 67,054,205 (GRCm39) E323D probably damaging Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pcsk5 T C 19: 17,432,236 (GRCm39) T1460A probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plch2 A T 4: 155,127,298 (GRCm39) probably benign Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc35b1 T G 11: 95,276,718 (GRCm39) F102V possibly damaging Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51,806,215 (GRCm39) missense probably benign
IGL00402:Hectd1 APN 12 51,815,891 (GRCm39) missense possibly damaging 0.94
IGL00419:Hectd1 APN 12 51,810,818 (GRCm39) missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51,823,272 (GRCm39) splice site probably benign
IGL00565:Hectd1 APN 12 51,837,181 (GRCm39) missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51,820,787 (GRCm39) missense probably benign 0.17
IGL00576:Hectd1 APN 12 51,806,092 (GRCm39) missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51,795,571 (GRCm39) missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51,838,173 (GRCm39) missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51,807,904 (GRCm39) missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51,849,057 (GRCm39) missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51,850,562 (GRCm39) missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51,849,593 (GRCm39) missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51,829,337 (GRCm39) missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51,841,280 (GRCm39) nonsense probably null
IGL01994:Hectd1 APN 12 51,844,725 (GRCm39) missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51,820,920 (GRCm39) missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51,815,974 (GRCm39) missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51,800,916 (GRCm39) splice site probably benign
IGL02177:Hectd1 APN 12 51,819,103 (GRCm39) missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51,844,635 (GRCm39) missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51,847,496 (GRCm39) critical splice donor site probably null
IGL02519:Hectd1 APN 12 51,815,894 (GRCm39) missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51,809,233 (GRCm39) missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51,810,864 (GRCm39) missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51,814,423 (GRCm39) missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51,837,396 (GRCm39) missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51,815,670 (GRCm39) missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51,791,550 (GRCm39) missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51,874,205 (GRCm39) missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51,815,957 (GRCm39) missense probably benign 0.00
IGL03078:Hectd1 APN 12 51,849,019 (GRCm39) missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51,847,671 (GRCm39) splice site probably benign
3-1:Hectd1 UTSW 12 51,800,590 (GRCm39) missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51,800,608 (GRCm39) missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51,815,891 (GRCm39) missense possibly damaging 0.94
R0268:Hectd1 UTSW 12 51,815,890 (GRCm39) missense probably damaging 0.99
R0409:Hectd1 UTSW 12 51,829,339 (GRCm39) missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51,795,440 (GRCm39) missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51,807,855 (GRCm39) missense probably benign 0.11
R1087:Hectd1 UTSW 12 51,823,355 (GRCm39) missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51,810,947 (GRCm39) splice site probably benign
R1350:Hectd1 UTSW 12 51,809,217 (GRCm39) missense probably benign
R1553:Hectd1 UTSW 12 51,820,661 (GRCm39) missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51,800,607 (GRCm39) missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51,791,571 (GRCm39) missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51,791,375 (GRCm39) missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51,800,590 (GRCm39) missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51,791,577 (GRCm39) missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51,853,350 (GRCm39) missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51,847,738 (GRCm39) missense probably benign 0.00
R1982:Hectd1 UTSW 12 51,832,624 (GRCm39) missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51,803,899 (GRCm39) splice site probably null
R2078:Hectd1 UTSW 12 51,795,325 (GRCm39) missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51,792,277 (GRCm39) missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51,853,245 (GRCm39) missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51,853,254 (GRCm39) missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51,815,791 (GRCm39) missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51,792,317 (GRCm39) missense probably benign 0.01
R3876:Hectd1 UTSW 12 51,815,513 (GRCm39) missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51,849,219 (GRCm39) critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51,821,533 (GRCm39) missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51,815,506 (GRCm39) nonsense probably null
R4116:Hectd1 UTSW 12 51,815,506 (GRCm39) nonsense probably null
R4169:Hectd1 UTSW 12 51,837,008 (GRCm39) missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51,798,835 (GRCm39) missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51,837,276 (GRCm39) missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51,798,715 (GRCm39) missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51,791,356 (GRCm39) missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51,834,695 (GRCm39) missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51,874,134 (GRCm39) critical splice donor site probably null
R4883:Hectd1 UTSW 12 51,831,030 (GRCm39) nonsense probably null
R4885:Hectd1 UTSW 12 51,847,505 (GRCm39) missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51,809,280 (GRCm39) missense probably benign 0.02
R4983:Hectd1 UTSW 12 51,831,045 (GRCm39) missense probably benign 0.01
R5007:Hectd1 UTSW 12 51,849,443 (GRCm39) missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51,797,171 (GRCm39) missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51,791,662 (GRCm39) missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51,874,272 (GRCm39) start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51,849,316 (GRCm39) critical splice donor site probably null
R5535:Hectd1 UTSW 12 51,849,109 (GRCm39) missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51,810,897 (GRCm39) missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51,820,618 (GRCm39) missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51,845,537 (GRCm39) missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51,849,035 (GRCm39) missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51,815,855 (GRCm39) missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51,800,887 (GRCm39) missense probably benign
R6141:Hectd1 UTSW 12 51,792,875 (GRCm39) critical splice donor site probably null
R6172:Hectd1 UTSW 12 51,816,065 (GRCm39) missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51,795,228 (GRCm39) missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51,791,402 (GRCm39) missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51,841,270 (GRCm39) missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51,810,945 (GRCm39) splice site probably null
R6971:Hectd1 UTSW 12 51,795,526 (GRCm39) nonsense probably null
R7079:Hectd1 UTSW 12 51,834,638 (GRCm39) missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51,874,134 (GRCm39) critical splice donor site probably null
R7171:Hectd1 UTSW 12 51,806,080 (GRCm39) missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51,832,635 (GRCm39) missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51,797,104 (GRCm39) missense probably benign
R7355:Hectd1 UTSW 12 51,838,081 (GRCm39) missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51,791,588 (GRCm39) splice site probably null
R7531:Hectd1 UTSW 12 51,853,150 (GRCm39) missense probably benign 0.33
R7532:Hectd1 UTSW 12 51,837,233 (GRCm39) missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51,849,003 (GRCm39) missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51,792,171 (GRCm39) missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51,819,343 (GRCm39) missense probably damaging 0.99
R7922:Hectd1 UTSW 12 51,836,978 (GRCm39) nonsense probably null
R8059:Hectd1 UTSW 12 51,837,161 (GRCm39) missense possibly damaging 0.53
R8085:Hectd1 UTSW 12 51,795,679 (GRCm39) missense probably damaging 0.97
R8145:Hectd1 UTSW 12 51,831,016 (GRCm39) missense possibly damaging 0.72
R8157:Hectd1 UTSW 12 51,838,073 (GRCm39) missense possibly damaging 0.53
R8405:Hectd1 UTSW 12 51,874,178 (GRCm39) missense probably benign 0.01
R8505:Hectd1 UTSW 12 51,797,145 (GRCm39) missense probably damaging 1.00
R8511:Hectd1 UTSW 12 51,834,654 (GRCm39) missense probably benign 0.01
R8697:Hectd1 UTSW 12 51,819,320 (GRCm39) critical splice donor site probably benign
R8725:Hectd1 UTSW 12 51,849,000 (GRCm39) missense possibly damaging 0.92
R8727:Hectd1 UTSW 12 51,849,000 (GRCm39) missense possibly damaging 0.92
R8911:Hectd1 UTSW 12 51,795,616 (GRCm39) missense probably damaging 0.99
R8983:Hectd1 UTSW 12 51,791,410 (GRCm39) missense probably damaging 0.97
R9037:Hectd1 UTSW 12 51,832,665 (GRCm39) missense possibly damaging 0.85
R9219:Hectd1 UTSW 12 51,800,612 (GRCm39) missense probably damaging 0.99
R9413:Hectd1 UTSW 12 51,792,880 (GRCm39) nonsense probably null
R9456:Hectd1 UTSW 12 51,832,584 (GRCm39) missense probably benign
R9513:Hectd1 UTSW 12 51,816,079 (GRCm39) missense possibly damaging 0.92
R9640:Hectd1 UTSW 12 51,795,197 (GRCm39) nonsense probably null
R9641:Hectd1 UTSW 12 51,816,047 (GRCm39) missense probably benign 0.00
R9713:Hectd1 UTSW 12 51,823,328 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGAGTGAGTGGAGTTGAGACC -3'
(R):5'- TCAGATGCAGCTTTCCCTGG -3'

Sequencing Primer
(F):5'- GCAGAGGTTCTAAAAGTTCAATTCCC -3'
(R):5'- AGCTTTCCCTGGCCCAG -3'
Posted On 2015-05-15