Mutagenetix > Incidental Mutation

Incidental Mutation 'R2061:Hectd1'

316286

Institutional Source

Beutler Lab

Gene Symbol

Hectd1

Ensembl Gene

ENSMUSG00000035247

Gene Name

HECT domain E3 ubiquitin protein ligase 1

Synonyms

b2b327Clo, opm, A630086P08Rik

MMRRC Submission

040066-MU

Accession Numbers

Genbank: NM_144788; MGI: 2384768

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51743722-51829536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51794444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 634 (D634E)

Ref Sequence

ENSEMBL: ENSMUSP00000046766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]

AlphaFold

Q69ZR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000042052
AA Change: D634E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: D634E

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	395	424	1.44e-1	SMART
ANK	426	455	2.81e-4	SMART
ANK	459	488	1.55e2	SMART
low complexity region	490	509	N/A	INTRINSIC
low complexity region	630	654	N/A	INTRINSIC
low complexity region	707	723	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
Pfam:Sad1_UNC	1107	1240	9.2e-27	PFAM
low complexity region	1259	1271	N/A	INTRINSIC
Pfam:MIB_HERC2	1277	1338	7.6e-27	PFAM
low complexity region	1373	1401	N/A	INTRINSIC
low complexity region	1441	1458	N/A	INTRINSIC
low complexity region	1484	1495	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1600	1630	N/A	INTRINSIC
low complexity region	1633	1651	N/A	INTRINSIC
low complexity region	1674	1703	N/A	INTRINSIC
low complexity region	1745	1752	N/A	INTRINSIC
PDB:2LC3\|A	1879	1966	4e-57	PDB
low complexity region	2101	2117	N/A	INTRINSIC
HECTc	2143	2610	8.32e-76	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179265
AA Change: D635E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: D635E

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	396	425	1.44e-1	SMART
ANK	427	456	2.81e-4	SMART
ANK	460	489	1.55e2	SMART
low complexity region	491	510	N/A	INTRINSIC
low complexity region	631	655	N/A	INTRINSIC
low complexity region	708	724	N/A	INTRINSIC
low complexity region	822	833	N/A	INTRINSIC
Pfam:Sad1_UNC	1112	1245	1.3e-26	PFAM
low complexity region	1264	1276	N/A	INTRINSIC
Pfam:MIB_HERC2	1282	1341	5.3e-26	PFAM
low complexity region	1378	1406	N/A	INTRINSIC
low complexity region	1446	1463	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1513	1529	N/A	INTRINSIC
low complexity region	1605	1635	N/A	INTRINSIC
low complexity region	1638	1656	N/A	INTRINSIC
low complexity region	1679	1708	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
PDB:2LC3\|A	1884	1971	3e-57	PDB
low complexity region	2106	2122	N/A	INTRINSIC
HECTc	2148	2618	4.5e-72	SMART

Meta Mutation Damage Score

0.0716

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (124/125)

MGI Phenotype

PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]

Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,268,314	M395V	probably benign	Het
2610507B11Rik	T	A	11: 78,268,749	C541*	probably null	Het
9130011E15Rik	C	T	19: 45,978,667	R12Q	probably damaging	Het
A4gnt	T	C	9: 99,620,359	S191P	probably damaging	Het
AI314180	G	T	4: 58,824,270	P1116T	probably damaging	Het
Ak2	C	T	4: 129,008,197	A221V	probably damaging	Het
Akap9	T	A	5: 3,961,010	V571E	probably damaging	Het
Amph	G	T	13: 19,125,035	E428*	probably null	Het
Arnt2	T	A	7: 84,343,870	D154V	probably damaging	Het
Arrdc1	G	A	2: 24,926,352	Q202*	probably null	Het
Ate1	A	G	7: 130,510,913	C72R	probably damaging	Het
Atox1	A	G	11: 55,454,898	V22A	possibly damaging	Het
Bbs12	A	T	3: 37,319,066	M3L	probably damaging	Het
BC067074	T	A	13: 113,318,094	W225R	probably damaging	Het
Bfsp1	A	G	2: 143,862,678	V85A	probably benign	Het
Caskin2	C	A	11: 115,803,630	V382F	probably benign	Het
Ccdc39	T	A	3: 33,819,896	M596L	probably damaging	Het
Cd22	C	T	7: 30,870,105	V529M	probably damaging	Het
Cd22	A	C	7: 30,876,156	Y154D	probably benign	Het
Cdadc1	T	A	14: 59,581,334	E348D	probably damaging	Het
Cdhr2	T	C	13: 54,720,818	V531A	probably damaging	Het
Cdk11b	A	G	4: 155,641,604		probably benign	Het
Cebpa	G	T	7: 35,119,522	R35L	probably damaging	Het
Chat	T	C	14: 32,446,873	N235S	probably benign	Het
Col12a1	T	A	9: 79,617,705	I2725F	possibly damaging	Het
Cracr2b	A	G	7: 141,465,280	E231G	probably damaging	Het
Cryaa	G	T	17: 31,681,055	A151S	probably benign	Het
Dab1	A	T	4: 104,678,741	I116F	probably damaging	Het
Ddx43	C	A	9: 78,396,104	N75K	probably benign	Het
Dmbt1	T	G	7: 131,099,133	C1014G	possibly damaging	Het
Dner	C	A	1: 84,405,989	C558F	probably damaging	Het
Dsc2	A	G	18: 20,032,399	V839A	possibly damaging	Het
Dsg3	C	T	18: 20,527,737	R378*	probably null	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha6	T	C	16: 59,655,797	M1069V	probably damaging	Het
F930017D23Rik	A	C	10: 43,604,420		noncoding transcript	Het
Faf1	A	T	4: 109,710,808	N22Y	probably damaging	Het
Flrt3	A	T	2: 140,661,453	V85E	probably damaging	Het
Gadl1	T	A	9: 115,941,380	I87N	probably damaging	Het
Galnt14	A	G	17: 73,512,153	F314S	probably damaging	Het
Gba2	A	T	4: 43,574,029	Y141*	probably null	Het
Gdap1	A	T	1: 17,145,465		probably benign	Het
Gfod1	A	T	13: 43,303,243		probably null	Het
Gm14295	C	T	2: 176,810,681	R655*	probably null	Het
Gm4353	A	G	7: 116,083,699	S216P	probably damaging	Het
Gm6605	T	A	7: 38,448,282		noncoding transcript	Het
Helz2	A	G	2: 181,240,544	I152T	probably damaging	Het
Hivep1	A	G	13: 42,160,124	K1947E	possibly damaging	Het
Ifrd1	A	T	12: 40,213,245	F144L	probably benign	Het
Itgae	A	T	11: 73,118,622	Q544L	probably benign	Het
Jmjd1c	A	T	10: 67,218,426	E323D	probably damaging	Het
Kdm5a	G	T	6: 120,381,617	R207L	probably benign	Het
Kif5b	C	T	18: 6,226,377		probably null	Het
Lbp	T	C	2: 158,324,579	V351A	probably benign	Het
Lss	A	T	10: 76,546,098		probably null	Het
Madd	A	C	2: 91,161,486		probably benign	Het
Map6	G	A	7: 99,317,472	V503I	probably damaging	Het
Mark1	A	G	1: 184,928,063	L22P	probably damaging	Het
Mcfd2	T	C	17: 87,255,976	N130D	probably damaging	Het
Mcm3ap	A	G	10: 76,470,068	N5S	probably benign	Het
Mdm4	A	T	1: 133,012,651	F48I	probably damaging	Het
Mga	A	T	2: 119,964,980		probably benign	Het
Mknk2	A	T	10: 80,671,557		probably null	Het
Mmp15	T	C	8: 95,370,779	Y459H	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,288	K879R	probably benign	Het
Mycbp2	T	C	14: 103,287,260	K655E	probably damaging	Het
Nasp	T	C	4: 116,611,126	N221D	probably benign	Het
Ndc80	T	C	17: 71,514,218	E245G	probably benign	Het
Nmral1	C	T	16: 4,716,329	E83K	probably damaging	Het
Noa1	T	A	5: 77,304,187	Q550L	possibly damaging	Het
Nutm1	A	T	2: 112,255,752	Y211*	probably null	Het
Olfr1420	T	A	19: 11,896,557	Y179N	probably damaging	Het
Olfr1474	A	G	19: 13,471,241	I90M	probably damaging	Het
Olfr148	G	T	9: 39,613,775	M69I	probably benign	Het
Olfr700	A	C	7: 106,805,768	H231Q	probably benign	Het
Olfr723	T	C	14: 49,929,021	I174M	possibly damaging	Het
Otoa	T	C	7: 121,131,328	F584L	probably damaging	Het
Palb2	G	A	7: 122,124,525	T304I	possibly damaging	Het
Pcolce2	A	T	9: 95,670,176	M121L	probably benign	Het
Pcsk5	T	C	19: 17,454,872	T1460A	probably benign	Het
Pdzrn4	A	T	15: 92,770,160	D731V	probably damaging	Het
Pex11b	C	A	3: 96,635,721	Q12K	possibly damaging	Het
Pigw	G	C	11: 84,877,310	Q398E	probably benign	Het
Pkd1	A	G	17: 24,569,914	E882G	possibly damaging	Het
Pkhd1	A	T	1: 20,612,812	N55K	possibly damaging	Het
Plch2	A	T	4: 155,042,841		probably benign	Het
Plcl1	T	A	1: 55,751,345	L1058Q	probably benign	Het
Ppfia2	T	C	10: 106,837,329	S511P	possibly damaging	Het
Ppfibp2	T	C	7: 107,739,230	L676P	probably damaging	Het
Ppp6c	T	G	2: 39,226,174	D23A	probably damaging	Het
Pqlc1	G	T	18: 80,291,715	A232S	probably benign	Het
Prss30	G	A	17: 23,974,668		probably benign	Het
Ptprz1	T	C	6: 23,049,675		probably null	Het
Rec114	T	A	9: 58,652,905		probably benign	Het
Ryr2	T	C	13: 11,665,878		probably null	Het
Ryr3	A	T	2: 112,663,004	I3715N	possibly damaging	Het
Scin	T	C	12: 40,080,948	Y322C	probably damaging	Het
Scn3a	A	G	2: 65,461,308	V1698A	probably damaging	Het
Scn5a	G	A	9: 119,485,651	S1996L	probably damaging	Het
Serpinb2	A	G	1: 107,522,795	K174R	possibly damaging	Het
Slc16a4	T	C	3: 107,300,711	I179T	probably benign	Het
Slc35b1	T	G	11: 95,385,892	F102V	possibly damaging	Het
Slc6a15	A	G	10: 103,409,734	D526G	probably benign	Het
Spata16	A	G	3: 26,924,370	D495G	probably damaging	Het
Stk11ip	G	A	1: 75,529,584	E583K	possibly damaging	Het
Stk-ps1	T	G	17: 36,398,152		noncoding transcript	Het
Sufu	T	A	19: 46,397,212	I37N	probably damaging	Het
Tacr1	C	T	6: 82,492,554	P140S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tenm3	C	T	8: 48,342,256		probably null	Het
Tex36	A	T	7: 133,595,223	I55N	probably damaging	Het
Tmem150c	T	C	5: 100,080,028	Y192C	probably damaging	Het
Tmem237	A	G	1: 59,120,286		probably benign	Het
Trim11	A	G	11: 58,982,063	E191G	probably damaging	Het
Ttll3	C	T	6: 113,409,042	A612V	possibly damaging	Het
Ttn	G	A	2: 76,977,122	A89V	probably damaging	Het
Usp37	A	G	1: 74,468,272	F529L	probably damaging	Het
Vmn1r217	A	C	13: 23,114,528	V68G	probably benign	Het
Vwf	T	C	6: 125,591,188	S349P	probably damaging	Het
Wt1	G	A	2: 105,131,157		probably null	Het
Zcchc7	T	A	4: 44,895,838	L262H	probably damaging	Het
Zfp873	A	G	10: 82,060,157	S241G	probably benign	Het

Other mutations in Hectd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Hectd1	APN	12	51769108	missense	possibly damaging	0.94
IGL00402:Hectd1	APN	12	51759432	missense	probably benign
IGL00419:Hectd1	APN	12	51764035	missense	probably damaging	0.99
IGL00518:Hectd1	APN	12	51776489	splice site	probably benign
IGL00565:Hectd1	APN	12	51790398	missense	probably damaging	0.97
IGL00574:Hectd1	APN	12	51774004	missense	probably benign	0.17
IGL00576:Hectd1	APN	12	51759309	missense	probably damaging	0.99
IGL00788:Hectd1	APN	12	51748788	missense	probably damaging	0.99
IGL00978:Hectd1	APN	12	51791390	missense	possibly damaging	0.95
IGL01328:Hectd1	APN	12	51761121	missense	probably damaging	1.00
IGL01337:Hectd1	APN	12	51802274	missense	possibly damaging	0.95
IGL01634:Hectd1	APN	12	51803779	missense	probably damaging	0.98
IGL01731:Hectd1	APN	12	51802810	missense	possibly damaging	0.59
IGL01920:Hectd1	APN	12	51782554	missense	probably damaging	0.99
IGL01951:Hectd1	APN	12	51794497	nonsense	probably null
IGL01994:Hectd1	APN	12	51797942	missense	probably damaging	0.99
IGL02140:Hectd1	APN	12	51774137	missense	probably damaging	0.99
IGL02150:Hectd1	APN	12	51769191	missense	probably damaging	0.97
IGL02156:Hectd1	APN	12	51754133	splice site	probably benign
IGL02177:Hectd1	APN	12	51772320	missense	probably damaging	0.99
IGL02502:Hectd1	APN	12	51797852	missense	possibly damaging	0.77
IGL02505:Hectd1	APN	12	51800713	critical splice donor site	probably null
IGL02519:Hectd1	APN	12	51769111	missense	probably damaging	0.99
IGL02624:Hectd1	APN	12	51762450	missense	possibly damaging	0.61
IGL02833:Hectd1	APN	12	51764081	missense	probably damaging	0.96
IGL02851:Hectd1	APN	12	51767640	missense	possibly damaging	0.94
IGL02866:Hectd1	APN	12	51790613	missense	probably damaging	1.00
IGL02981:Hectd1	APN	12	51768887	missense	possibly damaging	0.70
IGL02987:Hectd1	APN	12	51744767	missense	probably damaging	1.00
IGL02999:Hectd1	APN	12	51827422	missense	possibly damaging	0.77
IGL03071:Hectd1	APN	12	51769174	missense	probably benign	0.00
IGL03078:Hectd1	APN	12	51802236	missense	probably damaging	0.98
IGL03299:Hectd1	APN	12	51800888	splice site	probably benign
3-1:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R0039:Hectd1	UTSW	12	51753825	missense	possibly damaging	0.83
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0268:Hectd1	UTSW	12	51769107	missense	probably damaging	0.99
R0268:Hectd1	UTSW	12	51769108	missense	possibly damaging	0.94
R0409:Hectd1	UTSW	12	51782556	missense	possibly damaging	0.59
R1019:Hectd1	UTSW	12	51748657	missense	probably damaging	0.99
R1072:Hectd1	UTSW	12	51761072	missense	probably benign	0.11
R1087:Hectd1	UTSW	12	51776572	missense	probably damaging	0.99
R1165:Hectd1	UTSW	12	51764164	splice site	probably benign
R1350:Hectd1	UTSW	12	51762434	missense	probably benign
R1553:Hectd1	UTSW	12	51773878	missense	probably damaging	0.98
R1666:Hectd1	UTSW	12	51753824	missense	possibly damaging	0.91
R1676:Hectd1	UTSW	12	51744788	missense	probably damaging	1.00
R1694:Hectd1	UTSW	12	51744592	missense	probably damaging	1.00
R1778:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R1856:Hectd1	UTSW	12	51744794	missense	probably damaging	1.00
R1859:Hectd1	UTSW	12	51806567	missense	probably damaging	1.00
R1884:Hectd1	UTSW	12	51800955	missense	probably benign	0.00
R1982:Hectd1	UTSW	12	51785841	missense	probably damaging	0.97
R2034:Hectd1	UTSW	12	51757116	splice site	probably null
R2078:Hectd1	UTSW	12	51748542	missense	probably damaging	0.99
R2176:Hectd1	UTSW	12	51745494	missense	probably damaging	1.00
R2210:Hectd1	UTSW	12	51806462	missense	probably damaging	0.99
R2248:Hectd1	UTSW	12	51806471	missense	probably damaging	0.99
R2282:Hectd1	UTSW	12	51769008	missense	possibly damaging	0.95
R2402:Hectd1	UTSW	12	51745534	missense	probably benign	0.01
R3876:Hectd1	UTSW	12	51768730	missense	probably damaging	0.98
R4027:Hectd1	UTSW	12	51802436	critical splice acceptor site	probably null
R4085:Hectd1	UTSW	12	51774750	missense	possibly damaging	0.93
R4115:Hectd1	UTSW	12	51768723	nonsense	probably null
R4116:Hectd1	UTSW	12	51768723	nonsense	probably null
R4169:Hectd1	UTSW	12	51790225	missense	probably damaging	0.97
R4434:Hectd1	UTSW	12	51752052	missense	probably damaging	1.00
R4507:Hectd1	UTSW	12	51790493	missense	probably damaging	0.97
R4578:Hectd1	UTSW	12	51751932	missense	probably damaging	1.00
R4579:Hectd1	UTSW	12	51744573	missense	probably damaging	0.97
R4709:Hectd1	UTSW	12	51787912	missense	possibly damaging	0.94
R4812:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R4883:Hectd1	UTSW	12	51784247	nonsense	probably null
R4885:Hectd1	UTSW	12	51800722	missense	probably damaging	0.97
R4975:Hectd1	UTSW	12	51762497	missense	probably benign	0.02
R4983:Hectd1	UTSW	12	51784262	missense	probably benign	0.01
R5007:Hectd1	UTSW	12	51802660	missense	possibly damaging	0.95
R5046:Hectd1	UTSW	12	51750388	missense	probably damaging	1.00
R5062:Hectd1	UTSW	12	51744879	missense	probably damaging	0.98
R5164:Hectd1	UTSW	12	51827489	start codon destroyed	probably null	0.60
R5213:Hectd1	UTSW	12	51802533	critical splice donor site	probably null
R5535:Hectd1	UTSW	12	51802326	missense	probably damaging	0.98
R5776:Hectd1	UTSW	12	51764114	missense	possibly damaging	0.91
R5846:Hectd1	UTSW	12	51773835	missense	probably damaging	0.99
R5907:Hectd1	UTSW	12	51798754	missense	probably damaging	0.98
R5911:Hectd1	UTSW	12	51802252	missense	probably damaging	0.99
R5919:Hectd1	UTSW	12	51769072	missense	probably damaging	0.98
R6051:Hectd1	UTSW	12	51754104	missense	probably benign
R6141:Hectd1	UTSW	12	51746092	critical splice donor site	probably null
R6172:Hectd1	UTSW	12	51769282	missense	probably damaging	1.00
R6194:Hectd1	UTSW	12	51748445	missense	probably damaging	0.99
R6356:Hectd1	UTSW	12	51744619	missense	probably damaging	1.00
R6795:Hectd1	UTSW	12	51794487	missense	possibly damaging	0.94
R6909:Hectd1	UTSW	12	51764162	splice site	probably null
R6971:Hectd1	UTSW	12	51748743	nonsense	probably null
R7079:Hectd1	UTSW	12	51787855	missense	possibly damaging	0.96
R7104:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R7171:Hectd1	UTSW	12	51759297	missense	probably damaging	0.99
R7296:Hectd1	UTSW	12	51785852	missense	possibly damaging	0.73
R7346:Hectd1	UTSW	12	51750321	missense	probably benign
R7355:Hectd1	UTSW	12	51791298	missense	possibly damaging	0.72
R7468:Hectd1	UTSW	12	51744805	splice site	probably null
R7531:Hectd1	UTSW	12	51806367	missense	probably benign	0.33
R7532:Hectd1	UTSW	12	51790450	missense	probably damaging	0.98
R7755:Hectd1	UTSW	12	51802220	missense	possibly damaging	0.86
R7807:Hectd1	UTSW	12	51745388	missense	probably damaging	1.00
R7842:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R7922:Hectd1	UTSW	12	51790195	nonsense	probably null
R8059:Hectd1	UTSW	12	51790378	missense	possibly damaging	0.53
R8085:Hectd1	UTSW	12	51748896	missense	probably damaging	0.97
R8145:Hectd1	UTSW	12	51784233	missense	possibly damaging	0.72
R8157:Hectd1	UTSW	12	51791290	missense	possibly damaging	0.53
R8405:Hectd1	UTSW	12	51827395	missense	probably benign	0.01
R8505:Hectd1	UTSW	12	51750362	missense	probably damaging	1.00
R8511:Hectd1	UTSW	12	51787871	missense	probably benign	0.01
R8697:Hectd1	UTSW	12	51772537	critical splice donor site	probably benign
R8725:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8727:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8911:Hectd1	UTSW	12	51748833	missense	probably damaging	0.99
R8983:Hectd1	UTSW	12	51744627	missense	probably damaging	0.97
R9037:Hectd1	UTSW	12	51785882	missense	possibly damaging	0.85
R9219:Hectd1	UTSW	12	51753829	missense	probably damaging	0.99
R9413:Hectd1	UTSW	12	51746097	nonsense	probably null
R9456:Hectd1	UTSW	12	51785801	missense	probably benign
R9513:Hectd1	UTSW	12	51769296	missense	possibly damaging	0.92
R9640:Hectd1	UTSW	12	51748414	nonsense	probably null
R9641:Hectd1	UTSW	12	51769264	missense	probably benign	0.00
R9713:Hectd1	UTSW	12	51776545	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTGAGTGAGTGGAGTTGAGACC -3'
(R):5'- TCAGATGCAGCTTTCCCTGG -3'

Sequencing Primer
(F):5'- GCAGAGGTTCTAAAAGTTCAATTCCC -3'
(R):5'- AGCTTTCCCTGGCCCAG -3'

Posted On

2015-05-15