Mutagenetix > Incidental Mutation

Incidental Mutation 'R2061:Ryr2'

316287

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

040066-MU

Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11553102-12106945 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 11665878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000021750

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000170156

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221941

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (124/125)

MGI Phenotype

Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,268,314	M395V	probably benign	Het
2610507B11Rik	T	A	11: 78,268,749	C541*	probably null	Het
9130011E15Rik	C	T	19: 45,978,667	R12Q	probably damaging	Het
A4gnt	T	C	9: 99,620,359	S191P	probably damaging	Het
AI314180	G	T	4: 58,824,270	P1116T	probably damaging	Het
Ak2	C	T	4: 129,008,197	A221V	probably damaging	Het
Akap9	T	A	5: 3,961,010	V571E	probably damaging	Het
Amph	G	T	13: 19,125,035	E428*	probably null	Het
Arnt2	T	A	7: 84,343,870	D154V	probably damaging	Het
Arrdc1	G	A	2: 24,926,352	Q202*	probably null	Het
Ate1	A	G	7: 130,510,913	C72R	probably damaging	Het
Atox1	A	G	11: 55,454,898	V22A	possibly damaging	Het
Bbs12	A	T	3: 37,319,066	M3L	probably damaging	Het
BC067074	T	A	13: 113,318,094	W225R	probably damaging	Het
Bfsp1	A	G	2: 143,862,678	V85A	probably benign	Het
Caskin2	C	A	11: 115,803,630	V382F	probably benign	Het
Ccdc39	T	A	3: 33,819,896	M596L	probably damaging	Het
Cd22	C	T	7: 30,870,105	V529M	probably damaging	Het
Cd22	A	C	7: 30,876,156	Y154D	probably benign	Het
Cdadc1	T	A	14: 59,581,334	E348D	probably damaging	Het
Cdhr2	T	C	13: 54,720,818	V531A	probably damaging	Het
Cdk11b	A	G	4: 155,641,604		probably benign	Het
Cebpa	G	T	7: 35,119,522	R35L	probably damaging	Het
Chat	T	C	14: 32,446,873	N235S	probably benign	Het
Col12a1	T	A	9: 79,617,705	I2725F	possibly damaging	Het
Cracr2b	A	G	7: 141,465,280	E231G	probably damaging	Het
Cryaa	G	T	17: 31,681,055	A151S	probably benign	Het
Dab1	A	T	4: 104,678,741	I116F	probably damaging	Het
Ddx43	C	A	9: 78,396,104	N75K	probably benign	Het
Dmbt1	T	G	7: 131,099,133	C1014G	possibly damaging	Het
Dner	C	A	1: 84,405,989	C558F	probably damaging	Het
Dsc2	A	G	18: 20,032,399	V839A	possibly damaging	Het
Dsg3	C	T	18: 20,527,737	R378*	probably null	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha6	T	C	16: 59,655,797	M1069V	probably damaging	Het
F930017D23Rik	A	C	10: 43,604,420		noncoding transcript	Het
Faf1	A	T	4: 109,710,808	N22Y	probably damaging	Het
Flrt3	A	T	2: 140,661,453	V85E	probably damaging	Het
Gadl1	T	A	9: 115,941,380	I87N	probably damaging	Het
Galnt14	A	G	17: 73,512,153	F314S	probably damaging	Het
Gba2	A	T	4: 43,574,029	Y141*	probably null	Het
Gdap1	A	T	1: 17,145,465		probably benign	Het
Gfod1	A	T	13: 43,303,243		probably null	Het
Gm14295	C	T	2: 176,810,681	R655*	probably null	Het
Gm4353	A	G	7: 116,083,699	S216P	probably damaging	Het
Gm6605	T	A	7: 38,448,282		noncoding transcript	Het
Hectd1	A	T	12: 51,794,444	D634E	probably damaging	Het
Helz2	A	G	2: 181,240,544	I152T	probably damaging	Het
Hivep1	A	G	13: 42,160,124	K1947E	possibly damaging	Het
Ifrd1	A	T	12: 40,213,245	F144L	probably benign	Het
Itgae	A	T	11: 73,118,622	Q544L	probably benign	Het
Jmjd1c	A	T	10: 67,218,426	E323D	probably damaging	Het
Kdm5a	G	T	6: 120,381,617	R207L	probably benign	Het
Kif5b	C	T	18: 6,226,377		probably null	Het
Lbp	T	C	2: 158,324,579	V351A	probably benign	Het
Lss	A	T	10: 76,546,098		probably null	Het
Madd	A	C	2: 91,161,486		probably benign	Het
Map6	G	A	7: 99,317,472	V503I	probably damaging	Het
Mark1	A	G	1: 184,928,063	L22P	probably damaging	Het
Mcfd2	T	C	17: 87,255,976	N130D	probably damaging	Het
Mcm3ap	A	G	10: 76,470,068	N5S	probably benign	Het
Mdm4	A	T	1: 133,012,651	F48I	probably damaging	Het
Mga	A	T	2: 119,964,980		probably benign	Het
Mknk2	A	T	10: 80,671,557		probably null	Het
Mmp15	T	C	8: 95,370,779	Y459H	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,288	K879R	probably benign	Het
Mycbp2	T	C	14: 103,287,260	K655E	probably damaging	Het
Nasp	T	C	4: 116,611,126	N221D	probably benign	Het
Ndc80	T	C	17: 71,514,218	E245G	probably benign	Het
Nmral1	C	T	16: 4,716,329	E83K	probably damaging	Het
Noa1	T	A	5: 77,304,187	Q550L	possibly damaging	Het
Nutm1	A	T	2: 112,255,752	Y211*	probably null	Het
Olfr1420	T	A	19: 11,896,557	Y179N	probably damaging	Het
Olfr1474	A	G	19: 13,471,241	I90M	probably damaging	Het
Olfr148	G	T	9: 39,613,775	M69I	probably benign	Het
Olfr700	A	C	7: 106,805,768	H231Q	probably benign	Het
Olfr723	T	C	14: 49,929,021	I174M	possibly damaging	Het
Otoa	T	C	7: 121,131,328	F584L	probably damaging	Het
Palb2	G	A	7: 122,124,525	T304I	possibly damaging	Het
Pcolce2	A	T	9: 95,670,176	M121L	probably benign	Het
Pcsk5	T	C	19: 17,454,872	T1460A	probably benign	Het
Pdzrn4	A	T	15: 92,770,160	D731V	probably damaging	Het
Pex11b	C	A	3: 96,635,721	Q12K	possibly damaging	Het
Pigw	G	C	11: 84,877,310	Q398E	probably benign	Het
Pkd1	A	G	17: 24,569,914	E882G	possibly damaging	Het
Pkhd1	A	T	1: 20,612,812	N55K	possibly damaging	Het
Plch2	A	T	4: 155,042,841		probably benign	Het
Plcl1	T	A	1: 55,751,345	L1058Q	probably benign	Het
Ppfia2	T	C	10: 106,837,329	S511P	possibly damaging	Het
Ppfibp2	T	C	7: 107,739,230	L676P	probably damaging	Het
Ppp6c	T	G	2: 39,226,174	D23A	probably damaging	Het
Pqlc1	G	T	18: 80,291,715	A232S	probably benign	Het
Prss30	G	A	17: 23,974,668		probably benign	Het
Ptprz1	T	C	6: 23,049,675		probably null	Het
Rec114	T	A	9: 58,652,905		probably benign	Het
Ryr3	A	T	2: 112,663,004	I3715N	possibly damaging	Het
Scin	T	C	12: 40,080,948	Y322C	probably damaging	Het
Scn3a	A	G	2: 65,461,308	V1698A	probably damaging	Het
Scn5a	G	A	9: 119,485,651	S1996L	probably damaging	Het
Serpinb2	A	G	1: 107,522,795	K174R	possibly damaging	Het
Slc16a4	T	C	3: 107,300,711	I179T	probably benign	Het
Slc35b1	T	G	11: 95,385,892	F102V	possibly damaging	Het
Slc6a15	A	G	10: 103,409,734	D526G	probably benign	Het
Spata16	A	G	3: 26,924,370	D495G	probably damaging	Het
Stk11ip	G	A	1: 75,529,584	E583K	possibly damaging	Het
Stk-ps1	T	G	17: 36,398,152		noncoding transcript	Het
Sufu	T	A	19: 46,397,212	I37N	probably damaging	Het
Tacr1	C	T	6: 82,492,554	P140S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tenm3	C	T	8: 48,342,256		probably null	Het
Tex36	A	T	7: 133,595,223	I55N	probably damaging	Het
Tmem150c	T	C	5: 100,080,028	Y192C	probably damaging	Het
Tmem237	A	G	1: 59,120,286		probably benign	Het
Trim11	A	G	11: 58,982,063	E191G	probably damaging	Het
Ttll3	C	T	6: 113,409,042	A612V	possibly damaging	Het
Ttn	G	A	2: 76,977,122	A89V	probably damaging	Het
Usp37	A	G	1: 74,468,272	F529L	probably damaging	Het
Vmn1r217	A	C	13: 23,114,528	V68G	probably benign	Het
Vwf	T	C	6: 125,591,188	S349P	probably damaging	Het
Wt1	G	A	2: 105,131,157		probably null	Het
Zcchc7	T	A	4: 44,895,838	L262H	probably damaging	Het
Zfp873	A	G	10: 82,060,157	S241G	probably benign	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11834092	splice site	probably benign
IGL00757:Ryr2	APN	13	11618604	splice site	probably null
IGL00838:Ryr2	APN	13	11568503	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11585478	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11735502	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11703544	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11638485	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11587239	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11556685	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11591352	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11742036	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11799837	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11851204	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11721790	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11721761	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11601758	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11591316	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11594968	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11692677	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11585480	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11601842	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11595425	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11554550	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11790363	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11790363	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11597112	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11747564	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11572257	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11792762	nonsense	probably null
IGL02086:Ryr2	APN	13	11735556	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11759759	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11737873	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11741869	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11730388	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11747658	splice site	probably benign
IGL02369:Ryr2	APN	13	11619496	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11722721	splice site	probably benign
IGL02400:Ryr2	APN	13	11605244	splice site	probably benign
IGL02423:Ryr2	APN	13	11745198	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11745674	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11705699	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11554511	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11605189	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11738320	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11655677	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11595190	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11707793	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11918319	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11591269	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11759835	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11684479	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11643902	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11635582	splice site	probably benign
IGL03152:Ryr2	APN	13	11853150	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11742023	nonsense	probably null
IGL03180:Ryr2	APN	13	11568563	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11724387	splice site	probably benign
IGL03390:Ryr2	APN	13	11772416	missense	probably benign
IGL03410:Ryr2	APN	13	11588147	missense	probably damaging	0.99
Arruda	UTSW	13	11643895	missense	probably damaging	1.00
Arruda2	UTSW	13	11879496	missense	probably damaging	1.00
Arruda3	UTSW	13	11555448	missense	possibly damaging	0.91
barricuda	UTSW	13	11595014	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
BB006:Ryr2	UTSW	13	11690295	nonsense	probably null
BB016:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11690295	nonsense	probably null
H8562:Ryr2	UTSW	13	11717141	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11665962	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11761306	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11707796	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11594755	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11555448	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11824379	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11665919	missense	probably benign
R0018:Ryr2	UTSW	13	11595223	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11595784	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11595784	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11669038	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11869116	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11869116	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11568475	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11709921	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11714548	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11676251	splice site	probably benign
R0226:Ryr2	UTSW	13	11772556	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11716977	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11668839	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11705684	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11869156	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11834095	splice site	probably benign
R0558:Ryr2	UTSW	13	11638443	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11799861	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11731669	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11635559	missense	probably null
R0601:Ryr2	UTSW	13	11705633	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11622952	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11724333	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11566885	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11554529	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11738126	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11554529	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11669969	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11945981	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11660113	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11759703	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11883043	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11687879	splice site	probably benign
R1400:Ryr2	UTSW	13	11595076	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11714503	splice site	probably benign
R1443:Ryr2	UTSW	13	11779266	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11738149	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11727022	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11601841	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11554592	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11554549	nonsense	probably null
R1551:Ryr2	UTSW	13	11785143	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11759677	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11794563	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11718482	nonsense	probably null
R1686:Ryr2	UTSW	13	11603779	splice site	probably benign
R1696:Ryr2	UTSW	13	11731657	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11587442	splice site	probably null
R1728:Ryr2	UTSW	13	11587422	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11790267	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11745176	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11745176	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11700371	nonsense	probably null
R1801:Ryr2	UTSW	13	11595281	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11560586	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11587316	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11769878	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11731700	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11662075	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11738356	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11658958	nonsense	probably null
R1897:Ryr2	UTSW	13	11750932	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11591336	missense	probably benign
R1909:Ryr2	UTSW	13	11700349	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11556698	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11668962	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11731723	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11681080	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11585402	splice site	probably null
R2018:Ryr2	UTSW	13	11851188	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11851188	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11595736	missense	probably damaging	1.00
R2088:Ryr2	UTSW	13	11662229	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11712195	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11560607	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11577873	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11705793	nonsense	probably null
R2207:Ryr2	UTSW	13	11810937	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11662260	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11738216	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11738242	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11591237	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11801848	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11759703	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11593093	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11593093	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11761349	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11761349	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11772580	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11588159	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11738209	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11772427	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11918414	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11692682	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11779267	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11587437	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11737873	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11750725	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11649812	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11605233	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11717066	nonsense	probably null
R4430:Ryr2	UTSW	13	11735527	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12106415	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11749509	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11750685	splice site	probably null
R4668:Ryr2	UTSW	13	11593117	missense	probably benign
R4677:Ryr2	UTSW	13	11706667	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11824369	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11595233	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11692646	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11716998	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11737753	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11657047	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11708227	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11687932	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11708227	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11687932	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11717097	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11655698	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11668820	missense	probably damaging	0.99
R4850:Ryr2	UTSW	13	11745752	missense	probably damaging	1.00
R4880:Ryr2	UTSW	13	11752218	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11594986	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11594986	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11709963	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11945945	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11742011	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11785080	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11714611	missense	possibly damaging	0.49
R4964:Ryr2	UTSW	13	11833992	missense	probably benign	0.00
R4966:Ryr2	UTSW	13	11714611	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11833992	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11595306	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11643895	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11587254	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11635536	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11700354	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11712243	nonsense	probably null
R5135:Ryr2	UTSW	13	11662130	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11660289	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11752321	missense	probably benign
R5187:Ryr2	UTSW	13	11772452	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11638430	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11772437	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11690363	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11556658	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11655713	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11705656	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11705701	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11745601	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11687909	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11555448	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11595014	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11708202	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11601805	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11595582	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11759836	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11769962	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11603732	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11560574	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11584154	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11790332	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11687902	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11660122	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11726953	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11662238	nonsense	probably null
R5974:Ryr2	UTSW	13	11714511	splice site	probably null
R6104:Ryr2	UTSW	13	11799825	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11792689	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11669017	missense	probably benign
R6208:Ryr2	UTSW	13	11895220	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11834078	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11660107	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11879496	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11761396	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11662383	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11834007	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11668821	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11594723	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11710065	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11595643	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11594723	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11738462	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11686966	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11726930	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11829654	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11827559	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11745601	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11566948	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11801243	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11654380	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11712166	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11794605	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11824400	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11649776	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11669987	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11655713	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11640327	missense	possibly damaging	0.63
R7131:Ryr2	UTSW	13	11668811	critical splice donor site	probably null
R7159:Ryr2	UTSW	13	11810908	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11801177	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11686978	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11759757	missense	probably benign
R7189:Ryr2	UTSW	13	11883123	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11665913	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11597146	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11738194	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11745631	missense	probably benign
R7365:Ryr2	UTSW	13	11640275	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11785111	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11735620	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11556748	splice site	probably null
R7425:Ryr2	UTSW	13	11705644	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11555463	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11752282	missense	probably benign
R7460:Ryr2	UTSW	13	11705710	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11594876	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11638431	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11737985	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11799825	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11560653	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11761327	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11761315	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11690333	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11730343	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11751011	missense	probably benign
R7797:Ryr2	UTSW	13	11801180	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11827607	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11706623	nonsense	probably null
R7872:Ryr2	UTSW	13	11595724	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11792748	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11690295	nonsense	probably null
R7952:Ryr2	UTSW	13	11646427	splice site	probably null
R8008:Ryr2	UTSW	13	11657094	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11588140	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11945995	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11603698	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11827553	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11595506	nonsense	probably null
R8351:Ryr2	UTSW	13	11799832	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11668935	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11684478	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11659008	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11577778	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11560593	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11687989	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11686947	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11668969	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11735623	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11558048	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11779266	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11785104	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11799882	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11595038	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11603732	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11594786	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11738103	nonsense	probably null
R9056:Ryr2	UTSW	13	11595931	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11601838	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11603855	intron	probably benign
R9116:Ryr2	UTSW	13	11572299	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11654406	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11885538	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11829674	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11829674	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11595886	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11883116	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11750968	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11883090	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11883090	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11706692	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11883116	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11681087	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11794573	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11772577	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11737794	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11556604	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11587215	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11745218	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11668962	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11722760	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11687049	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11594899	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11692713	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11869156	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11703501	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11598611	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11643803	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11794549	nonsense	probably null
Z1177:Ryr2	UTSW	13	11750873	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TGAGCAACCTCATTCCAGC -3'
(R):5'- TGTTTTAACTCAGGGGAGGTAGAAG -3'

Sequencing Primer
(F):5'- AGCCCACTGTTCCCTTACAAG -3'
(R):5'- GTCACTCCTTCAGTTATTCATATGG -3'

Posted On

2015-05-15