Incidental Mutation 'R2061:Pcsk5'
ID 316314
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Name proprotein convertase subtilisin/kexin type 5
Synonyms PC5A, PC5/6A, PC6, b2b1549Clo, b2b585Clo, SPC6
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 17409683-17814996 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17432236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1460 (T1460A)
Ref Sequence ENSEMBL: ENSMUSP00000025618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618]
AlphaFold Q04592
Predicted Effect probably benign
Transcript: ENSMUST00000025618
AA Change: T1460A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: T1460A

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Col12a1 T A 9: 79,524,987 (GRCm39) I2725F possibly damaging Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,841,227 (GRCm39) D634E probably damaging Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Hivep1 A G 13: 42,313,600 (GRCm39) K1947E possibly damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Jmjd1c A T 10: 67,054,205 (GRCm39) E323D probably damaging Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plch2 A T 4: 155,127,298 (GRCm39) probably benign Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc35b1 T G 11: 95,276,718 (GRCm39) F102V possibly damaging Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17,488,785 (GRCm39) missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17,619,923 (GRCm39) missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17,429,322 (GRCm39) missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17,595,108 (GRCm39) missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17,411,144 (GRCm39) splice site probably benign
IGL01874:Pcsk5 APN 19 17,573,041 (GRCm39) missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17,416,406 (GRCm39) missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17,410,784 (GRCm39) nonsense probably null
IGL02436:Pcsk5 APN 19 17,542,072 (GRCm39) critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17,488,920 (GRCm39) missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17,455,236 (GRCm39) critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17,434,134 (GRCm39) missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17,652,832 (GRCm39) missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17,424,865 (GRCm39) missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17,416,466 (GRCm39) missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17,632,225 (GRCm39) missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17,632,225 (GRCm39) missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17,542,179 (GRCm39) missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17,542,179 (GRCm39) missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17,632,213 (GRCm39) missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17,692,133 (GRCm39) missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17,632,182 (GRCm39) missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17,542,194 (GRCm39) missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17,814,512 (GRCm39) missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17,541,246 (GRCm39) nonsense probably null
R1471:Pcsk5 UTSW 19 17,545,688 (GRCm39) missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17,632,120 (GRCm39) missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17,413,964 (GRCm39) missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17,492,620 (GRCm39) missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17,424,938 (GRCm39) missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17,432,232 (GRCm39) missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17,729,458 (GRCm39) missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17,432,114 (GRCm39) missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17,492,556 (GRCm39) missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17,410,825 (GRCm39) missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17,410,782 (GRCm39) missense unknown
R2006:Pcsk5 UTSW 19 17,455,280 (GRCm39) missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17,558,508 (GRCm39) missense possibly damaging 0.48
R2110:Pcsk5 UTSW 19 17,450,423 (GRCm39) missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17,452,198 (GRCm39) nonsense probably null
R2496:Pcsk5 UTSW 19 17,443,522 (GRCm39) nonsense probably null
R4115:Pcsk5 UTSW 19 17,410,783 (GRCm39) missense unknown
R4504:Pcsk5 UTSW 19 17,429,319 (GRCm39) missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17,538,114 (GRCm39) missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17,450,405 (GRCm39) missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17,502,631 (GRCm39) missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17,814,512 (GRCm39) missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17,410,963 (GRCm39) missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17,425,054 (GRCm39) missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17,492,499 (GRCm39) critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17,652,949 (GRCm39) missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17,440,798 (GRCm39) missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17,542,174 (GRCm39) missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17,573,022 (GRCm39) splice site probably null
R5334:Pcsk5 UTSW 19 17,439,215 (GRCm39) missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17,558,619 (GRCm39) missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17,440,720 (GRCm39) missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17,729,488 (GRCm39) missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17,553,195 (GRCm39) missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17,434,193 (GRCm39) missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17,432,045 (GRCm39) critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17,488,920 (GRCm39) missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17,488,856 (GRCm39) missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17,450,405 (GRCm39) missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17,814,317 (GRCm39) critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17,558,631 (GRCm39) missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17,595,093 (GRCm39) missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17,488,744 (GRCm39) missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17,553,185 (GRCm39) missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17,434,150 (GRCm39) missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17,549,986 (GRCm39) splice site probably null
R6837:Pcsk5 UTSW 19 17,416,448 (GRCm39) missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17,450,476 (GRCm39) missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17,411,095 (GRCm39) missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17,429,349 (GRCm39) missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17,455,241 (GRCm39) missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17,434,182 (GRCm39) nonsense probably null
R7360:Pcsk5 UTSW 19 17,492,577 (GRCm39) missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17,652,880 (GRCm39) missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17,487,600 (GRCm39) missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17,432,196 (GRCm39) missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17,619,954 (GRCm39) missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17,814,336 (GRCm39) missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17,549,821 (GRCm39) missense probably benign
R7631:Pcsk5 UTSW 19 17,542,144 (GRCm39) missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17,434,168 (GRCm39) missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17,558,593 (GRCm39) missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17,416,444 (GRCm39) missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17,549,847 (GRCm39) missense probably damaging 0.98
R7938:Pcsk5 UTSW 19 17,443,549 (GRCm39) critical splice acceptor site probably null
R8025:Pcsk5 UTSW 19 17,538,415 (GRCm39) intron probably benign
R8032:Pcsk5 UTSW 19 17,692,151 (GRCm39) missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17,692,225 (GRCm39) missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17,487,530 (GRCm39) critical splice donor site probably null
R8193:Pcsk5 UTSW 19 17,563,415 (GRCm39) missense possibly damaging 0.64
R8408:Pcsk5 UTSW 19 17,410,809 (GRCm39) missense probably benign 0.00
R8466:Pcsk5 UTSW 19 17,549,864 (GRCm39) nonsense probably null
R8739:Pcsk5 UTSW 19 17,432,138 (GRCm39) missense probably benign 0.00
R8753:Pcsk5 UTSW 19 17,446,408 (GRCm39) missense probably benign 0.00
R8797:Pcsk5 UTSW 19 17,443,472 (GRCm39) missense probably benign 0.00
R8944:Pcsk5 UTSW 19 17,452,275 (GRCm39) missense probably damaging 0.96
R9041:Pcsk5 UTSW 19 17,538,132 (GRCm39) nonsense probably null
R9135:Pcsk5 UTSW 19 17,563,472 (GRCm39) missense
R9288:Pcsk5 UTSW 19 17,814,345 (GRCm39) missense probably benign 0.10
R9406:Pcsk5 UTSW 19 17,771,097 (GRCm39) missense probably benign 0.14
R9581:Pcsk5 UTSW 19 17,432,196 (GRCm39) missense probably benign
R9592:Pcsk5 UTSW 19 17,652,899 (GRCm39) nonsense probably null
R9659:Pcsk5 UTSW 19 17,455,245 (GRCm39) missense probably benign 0.00
R9788:Pcsk5 UTSW 19 17,455,245 (GRCm39) missense probably benign 0.00
X0023:Pcsk5 UTSW 19 17,452,236 (GRCm39) missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17,424,968 (GRCm39) missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17,440,738 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAAAGTCTCTCTGGGACAG -3'
(R):5'- TGACGGTAGAAAGGCCACATAC -3'

Sequencing Primer
(F):5'- ACAGGTATAGCACTGGTCCTC -3'
(R):5'- GCGACCTTTCTCACAGTGTGG -3'
Posted On 2015-05-15