Incidental Mutation 'R4072:Pde7a'
ID316320
Institutional Source Beutler Lab
Gene Symbol Pde7a
Ensembl Gene ENSMUSG00000069094
Gene Namephosphodiesterase 7A
Synonyms
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19223108-19311322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19256853 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 70 (R70C)
Ref Sequence ENSEMBL: ENSMUSP00000119685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091314] [ENSMUST00000099195] [ENSMUST00000121951] [ENSMUST00000149081] [ENSMUST00000156652]
Predicted Effect probably damaging
Transcript: ENSMUST00000091314
AA Change: R44C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088863
Gene: ENSMUSG00000069094
AA Change: R44C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HDc 183 350 2.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099195
AA Change: R70C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096800
Gene: ENSMUSG00000069094
AA Change: R70C

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
HDc 209 376 2.91e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121951
AA Change: R44C

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113173
Gene: ENSMUSG00000069094
AA Change: R44C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143120
Predicted Effect probably damaging
Transcript: ENSMUST00000149081
AA Change: R7C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000156652
AA Change: R70C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119685
Gene: ENSMUSG00000069094
AA Change: R70C

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
Meta Mutation Damage Score 0.5733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous inactivation of this locus does not impair T cell function but affects the humoral immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Pde7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pde7a APN 3 19229679 unclassified probably benign
IGL02644:Pde7a APN 3 19256867 splice site probably benign
IGL02968:Pde7a APN 3 19243121 nonsense probably null
IGL02985:Pde7a APN 3 19310883 missense probably damaging 1.00
R0081:Pde7a UTSW 3 19241533 splice site probably benign
R0736:Pde7a UTSW 3 19231043 missense probably damaging 1.00
R0834:Pde7a UTSW 3 19230318 missense probably damaging 1.00
R1499:Pde7a UTSW 3 19260244 missense possibly damaging 0.49
R1955:Pde7a UTSW 3 19227799 missense probably damaging 0.99
R2943:Pde7a UTSW 3 19230325 missense probably damaging 1.00
R4366:Pde7a UTSW 3 19310862 critical splice donor site probably null
R4524:Pde7a UTSW 3 19230976 missense possibly damaging 0.93
R4666:Pde7a UTSW 3 19260256 missense probably damaging 1.00
R4698:Pde7a UTSW 3 19310931 missense probably damaging 0.99
R4850:Pde7a UTSW 3 19243117 missense probably benign
R4859:Pde7a UTSW 3 19241491 intron probably benign
R5283:Pde7a UTSW 3 19260256 missense probably damaging 1.00
R5646:Pde7a UTSW 3 19233773 missense probably damaging 1.00
R5702:Pde7a UTSW 3 19241207 nonsense probably null
R5756:Pde7a UTSW 3 19264845 missense probably benign 0.08
R5784:Pde7a UTSW 3 19264845 missense probably benign 0.08
R6301:Pde7a UTSW 3 19243163 missense probably benign 0.01
R7136:Pde7a UTSW 3 19231094 missense probably benign 0.36
R7291:Pde7a UTSW 3 19227674 missense probably benign
R7685:Pde7a UTSW 3 19227745 missense probably damaging 1.00
R8032:Pde7a UTSW 3 19260265 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCAAACAATAACACAGCATTTT -3'
(R):5'- GGCACTCTCATATATGTCACGT -3'

Sequencing Primer
(F):5'- CTGAGAAAACTAAATGCTAGAA -3'
(R):5'- CATATATGTCACGTATGTGTCGC -3'
Posted On2015-05-15