Incidental Mutation 'R4072:Slc30a7'
ID 316323
Institutional Source Beutler Lab
Gene Symbol Slc30a7
Ensembl Gene ENSMUSG00000054414
Gene Name solute carrier family 30 (zinc transporter), member 7
Synonyms 2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock # R4072 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 115938973-116007406 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115946680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 374 (D374G)
Ref Sequence ENSEMBL: ENSMUSP00000065254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067485]
AlphaFold Q9JKN1
Predicted Effect probably damaging
Transcript: ENSMUST00000067485
AA Change: D374G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414
AA Change: D374G

DomainStartEndE-ValueType
Pfam:Cation_efflux 38 296 3.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199743
Meta Mutation Damage Score 0.3546 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Slc30a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Slc30a7 APN 3 115946720 splice site probably null
IGL01161:Slc30a7 APN 3 115954110 missense possibly damaging 0.54
IGL01360:Slc30a7 APN 3 115990116 missense probably damaging 1.00
IGL02573:Slc30a7 APN 3 115990147 splice site probably benign
R0833:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R0836:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R1381:Slc30a7 UTSW 3 115956870 critical splice donor site probably null
R2445:Slc30a7 UTSW 3 115978653 missense probably damaging 1.00
R4850:Slc30a7 UTSW 3 115993008 missense probably damaging 0.99
R5429:Slc30a7 UTSW 3 116006925 missense possibly damaging 0.90
R5586:Slc30a7 UTSW 3 115990051 missense probably benign 0.36
R6170:Slc30a7 UTSW 3 115990743 missense probably damaging 1.00
R6813:Slc30a7 UTSW 3 115981811 missense probably benign 0.01
R6889:Slc30a7 UTSW 3 115954153 missense probably damaging 1.00
R8445:Slc30a7 UTSW 3 116007346 unclassified probably benign
R8872:Slc30a7 UTSW 3 115946668 missense possibly damaging 0.69
X0023:Slc30a7 UTSW 3 115990025 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGCAGTCAGAATGGCTTG -3'
(R):5'- TTCCTGTAGTAGTTTGACGACTTAC -3'

Sequencing Primer
(F):5'- AGGATCCGGCTGTGACAC -3'
(R):5'- GTTTGACGACTTACAATGAAAATGG -3'
Posted On 2015-05-15