Incidental Mutation 'R4072:Tox'
ID316324
Institutional Source Beutler Lab
Gene Symbol Tox
Ensembl Gene ENSMUSG00000041272
Gene Namethymocyte selection-associated high mobility group box
Synonyms1700007F02Rik
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location6686353-6991557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6842396 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 45 (T45A)
Ref Sequence ENSEMBL: ENSMUSP00000037966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039987]
PDB Structure
Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000039987
AA Change: T45A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037966
Gene: ENSMUSG00000041272
AA Change: T45A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
HMG 260 330 1.11e-19 SMART
low complexity region 416 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150082
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele have a severe block in thymic positive selection leading to loss of CD4 T lineage cells, and display decreased NK cell numbers, severely reduced numbers of lymphoid tissue inducer cells, absence of all peripheral lymph nodes, and loss of Peyer's patches. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Tox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Tox APN 4 6697583 missense probably damaging 0.99
IGL01481:Tox APN 4 6842396 missense probably damaging 0.99
IGL01600:Tox APN 4 6697585 missense probably damaging 0.98
IGL01616:Tox APN 4 6688430 missense probably damaging 0.99
IGL02160:Tox APN 4 6711537 missense probably damaging 0.99
IGL02390:Tox APN 4 6697534 missense possibly damaging 0.90
IGL03243:Tox APN 4 6697597 missense possibly damaging 0.76
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1159:Tox UTSW 4 6697600 missense probably benign 0.37
R1903:Tox UTSW 4 6688948 missense probably damaging 0.99
R1961:Tox UTSW 4 6688886 missense probably damaging 0.96
R2484:Tox UTSW 4 6688886 missense probably damaging 0.96
R3692:Tox UTSW 4 6697535 missense probably benign 0.05
R4635:Tox UTSW 4 6990501 utr 5 prime probably benign
R4815:Tox UTSW 4 6823033 missense probably benign
R5099:Tox UTSW 4 6688958 missense probably benign 0.28
R5421:Tox UTSW 4 6842409 missense possibly damaging 0.79
R5537:Tox UTSW 4 6697510 missense probably damaging 1.00
R5630:Tox UTSW 4 6688835 small insertion probably benign
R5883:Tox UTSW 4 6697444 missense probably benign
R6351:Tox UTSW 4 6697439 missense probably benign
R6351:Tox UTSW 4 6741536 missense probably benign 0.11
R6448:Tox UTSW 4 6822975 missense probably benign 0.08
R6934:Tox UTSW 4 6697635 missense probably damaging 0.98
R7513:Tox UTSW 4 6741507 missense probably benign
R8223:Tox UTSW 4 6842408 missense probably damaging 1.00
Z1088:Tox UTSW 4 6688450 missense probably damaging 1.00
Z1176:Tox UTSW 4 6990629 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCCATCTCATTAACTGGAAAC -3'
(R):5'- TGTGGCTCACTCACTACAACAG -3'

Sequencing Primer
(F):5'- ATCTCATTAACTGGAAACAAGGC -3'
(R):5'- GGCTCACTCACTACAACAGATTCTTC -3'
Posted On2015-05-15