Incidental Mutation 'R4072:Pms2'
ID316331
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene NamePMS1 homolog2, mismatch repair system component
Synonymsmismatch repair, DNA mismatch repair
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143909964-143933968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143929001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 742 (I742T)
Ref Sequence ENSEMBL: ENSMUSP00000119875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999] [ENSMUST00000166847]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110707
Predicted Effect probably benign
Transcript: ENSMUST00000110709
AA Change: I344T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109
AA Change: I344T

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141942
Predicted Effect probably damaging
Transcript: ENSMUST00000148011
AA Change: I742T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: I742T

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164999
SMART Domains Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
DNA_mis_repair 1 70 4.47e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166847
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170083
Predicted Effect unknown
Transcript: ENSMUST00000172367
AA Change: I61T
SMART Domains Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633
AA Change: I61T

DomainStartEndE-ValueType
MutL_C 5 139 1.78e-1 SMART
Meta Mutation Damage Score 0.5077 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143923519 missense probably damaging 1.00
IGL02009:Pms2 APN 5 143925764 missense probably benign 0.42
IGL02801:Pms2 APN 5 143925835 missense probably benign 0.06
P0047:Pms2 UTSW 5 143919598 missense probably damaging 1.00
R1367:Pms2 UTSW 5 143925913 missense probably damaging 1.00
R1422:Pms2 UTSW 5 143913705 missense probably damaging 1.00
R1854:Pms2 UTSW 5 143925896 missense probably benign 0.08
R1997:Pms2 UTSW 5 143913700 missense probably damaging 1.00
R2248:Pms2 UTSW 5 143916506 missense probably damaging 1.00
R2873:Pms2 UTSW 5 143911914 splice site probably benign
R4082:Pms2 UTSW 5 143931019 missense probably damaging 1.00
R4358:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R5100:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5101:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5228:Pms2 UTSW 5 143923597 missense probably damaging 0.99
R5484:Pms2 UTSW 5 143928125 missense probably damaging 1.00
R6310:Pms2 UTSW 5 143923583 missense probably benign 0.06
R6331:Pms2 UTSW 5 143914633 missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143928968 missense probably damaging 0.99
R6718:Pms2 UTSW 5 143923489 missense probably damaging 0.98
R6747:Pms2 UTSW 5 143925419 missense probably benign 0.02
R6980:Pms2 UTSW 5 143912024 missense probably benign 0.21
R7207:Pms2 UTSW 5 143913634 missense probably damaging 1.00
R7349:Pms2 UTSW 5 143925836 missense probably benign 0.11
R7657:Pms2 UTSW 5 143919539 missense possibly damaging 0.93
R7820:Pms2 UTSW 5 143914633 missense possibly damaging 0.80
X0064:Pms2 UTSW 5 143916466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAGGCCTGGTGTAGAGCAG -3'
(R):5'- CCTTTCAGTGACTGGAGCTACAAG -3'

Sequencing Primer
(F):5'- AGCAGTGCAGACCTTTTCAG -3'
(R):5'- TGAACCCACACTTCTACG -3'
Posted On2015-05-15