Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Pms2'

316331

Institutional Source

Beutler Lab

Gene Symbol

Pms2

Ensembl Gene

ENSMUSG00000079109

Gene Name

PMS1 homolog2, mismatch repair system component

Synonyms

mismatch repair, DNA mismatch repair

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143909964-143933968 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143929001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 742 (I742T)

Ref Sequence

ENSEMBL: ENSMUSP00000119875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999] [ENSMUST00000166847]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000031618

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110707

Predicted Effect

probably benign
Transcript: ENSMUST00000110709
AA Change: I344T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109
AA Change: I344T

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
MutL_C	277	421	1.59e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141942

Predicted Effect

probably damaging
Transcript: ENSMUST00000148011
AA Change: I742T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: I742T

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
DNA_mis_repair	227	364	4.76e-41	SMART
MutL_C	675	819	1.59e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164999

SMART Domains

Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109

Domain	Start	End	E-Value	Type
DNA_mis_repair	1	70	4.47e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166847

SMART Domains

Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	39	50	N/A	INTRINSIC
low complexity region	63	75	N/A	INTRINSIC
MORN	107	128	5.9e-7	SMART
MORN	130	151	9.35e-1	SMART
MORN	153	174	1.23e0	SMART
MORN	177	198	1.84e0	SMART
MORN	202	223	3.21e1	SMART
MORN	225	246	1.67e-6	SMART
MORN	249	270	1.85e1	SMART
MORN	282	303	2.71e-6	SMART
MORN	305	326	3.53e-5	SMART
low complexity region	409	420	N/A	INTRINSIC
low complexity region	629	649	N/A	INTRINSIC
coiled coil region	787	841	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170083

Predicted Effect

unknown
Transcript: ENSMUST00000172367
AA Change: I61T

SMART Domains

Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633
AA Change: I61T

Domain	Start	End	E-Value	Type
MutL_C	5	139	1.78e-1	SMART

Meta Mutation Damage Score

0.5077

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Pms2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01893:Pms2	APN	5	143923519	missense	probably damaging	1.00
IGL02009:Pms2	APN	5	143925764	missense	probably benign	0.42
IGL02801:Pms2	APN	5	143925835	missense	probably benign	0.06
P0047:Pms2	UTSW	5	143919598	missense	probably damaging	1.00
R1367:Pms2	UTSW	5	143925913	missense	probably damaging	1.00
R1422:Pms2	UTSW	5	143913705	missense	probably damaging	1.00
R1854:Pms2	UTSW	5	143925896	missense	probably benign	0.08
R1997:Pms2	UTSW	5	143913700	missense	probably damaging	1.00
R2248:Pms2	UTSW	5	143916506	missense	probably damaging	1.00
R2873:Pms2	UTSW	5	143911914	splice site	probably benign
R4082:Pms2	UTSW	5	143931019	missense	probably damaging	1.00
R4358:Pms2	UTSW	5	143925926	missense	probably damaging	1.00
R5100:Pms2	UTSW	5	143928188	missense	probably damaging	1.00
R5101:Pms2	UTSW	5	143928188	missense	probably damaging	1.00
R5228:Pms2	UTSW	5	143923597	missense	probably damaging	0.99
R5484:Pms2	UTSW	5	143928125	missense	probably damaging	1.00
R6310:Pms2	UTSW	5	143923583	missense	probably benign	0.06
R6331:Pms2	UTSW	5	143914633	missense	possibly damaging	0.94
R6567:Pms2	UTSW	5	143928968	missense	probably damaging	0.99
R6718:Pms2	UTSW	5	143923489	missense	probably damaging	0.98
R6747:Pms2	UTSW	5	143925419	missense	probably benign	0.02
R6980:Pms2	UTSW	5	143912024	missense	probably benign	0.21
R7207:Pms2	UTSW	5	143913634	missense	probably damaging	1.00
R7349:Pms2	UTSW	5	143925836	missense	probably benign	0.11
R7657:Pms2	UTSW	5	143919539	missense	possibly damaging	0.93
R7820:Pms2	UTSW	5	143914633	missense	possibly damaging	0.80
R7980:Pms2	UTSW	5	143931091	missense	probably damaging	1.00
R8213:Pms2	UTSW	5	143914771	missense	probably damaging	1.00
R8534:Pms2	UTSW	5	143923627	missense	probably benign	0.16
R9021:Pms2	UTSW	5	143925926	missense	probably damaging	1.00
R9218:Pms2	UTSW	5	143931127	missense	probably benign
R9494:Pms2	UTSW	5	143916396	missense	probably damaging	1.00
R9614:Pms2	UTSW	5	143917602	missense	probably benign	0.01
R9712:Pms2	UTSW	5	143914796	missense	probably damaging	0.99
X0064:Pms2	UTSW	5	143916466	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTAGGCCTGGTGTAGAGCAG -3'
(R):5'- CCTTTCAGTGACTGGAGCTACAAG -3'

Sequencing Primer
(F):5'- AGCAGTGCAGACCTTTTCAG -3'
(R):5'- TGAACCCACACTTCTACG -3'

Posted On

2015-05-15