Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Scnn1a'

316334

Institutional Source

Beutler Lab

Gene Symbol

Scnn1a

Ensembl Gene

ENSMUSG00000030340

Gene Name

sodium channel, nonvoltage-gated 1 alpha

Synonyms

ENaC alpha, mENaC, Scnn1

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125320659-125344943 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125338907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 407 (N407S)

Ref Sequence

ENSEMBL: ENSMUSP00000134929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000081440
AA Change: N433S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: N433S

Domain	Start	End	E-Value	Type
low complexity region	13	18	N/A	INTRINSIC
Pfam:ASC	88	600	1.1e-93	PFAM
low complexity region	647	677	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175966

SMART Domains

Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340

Domain	Start	End	E-Value	Type
Pfam:ASC	62	264	3.5e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176110
AA Change: N407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: N407S

Domain	Start	End	E-Value	Type
Pfam:ASC	62	575	1.9e-112	PFAM
low complexity region	621	651	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176442
AA Change: N326S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340
AA Change: N326S

Domain	Start	End	E-Value	Type
Pfam:ASC	1	494	6.3e-105	PFAM
low complexity region	540	570	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176655
AA Change: N326S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340
AA Change: N326S

Domain	Start	End	E-Value	Type
Pfam:ASC	1	494	6.4e-105	PFAM
low complexity region	540	570	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177329
AA Change: N407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: N407S

Domain	Start	End	E-Value	Type
Pfam:ASC	62	575	1.9e-112	PFAM
low complexity region	621	651	N/A	INTRINSIC

Meta Mutation Damage Score

0.3118

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Scnn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Scnn1a	APN	6	125338379	missense	probably benign	0.11
IGL01793:Scnn1a	APN	6	125343703	missense	probably benign	0.03
IGL01992:Scnn1a	APN	6	125338937	critical splice donor site	probably null
IGL03280:Scnn1a	APN	6	125342781	splice site	probably benign
scylla	UTSW	6	125343245	missense	probably damaging	0.98
R0086:Scnn1a	UTSW	6	125342587	splice site	probably benign
R0442:Scnn1a	UTSW	6	125339137	missense	probably damaging	1.00
R0454:Scnn1a	UTSW	6	125322226	missense	probably damaging	1.00
R0578:Scnn1a	UTSW	6	125322244	missense	probably damaging	0.97
R1538:Scnn1a	UTSW	6	125338893	missense	possibly damaging	0.48
R1579:Scnn1a	UTSW	6	125322140	missense	probably damaging	1.00
R1803:Scnn1a	UTSW	6	125332194	missense	probably damaging	0.98
R1876:Scnn1a	UTSW	6	125338838	missense	probably benign	0.05
R2113:Scnn1a	UTSW	6	125337811	missense	possibly damaging	0.60
R2178:Scnn1a	UTSW	6	125331002	missense	probably damaging	0.96
R2960:Scnn1a	UTSW	6	125322293	missense	probably damaging	1.00
R4603:Scnn1a	UTSW	6	125322160	missense	probably damaging	1.00
R4928:Scnn1a	UTSW	6	125322173	missense	probably damaging	1.00
R5436:Scnn1a	UTSW	6	125343022	missense	possibly damaging	0.94
R6812:Scnn1a	UTSW	6	125337856	missense	probably benign	0.09
R7089:Scnn1a	UTSW	6	125337807	missense	probably benign	0.05
R8371:Scnn1a	UTSW	6	125343843	missense	possibly damaging	0.83
R8372:Scnn1a	UTSW	6	125343718	missense	probably damaging	0.96
R8841:Scnn1a	UTSW	6	125343245	missense	probably damaging	0.98
R9509:Scnn1a	UTSW	6	125342641	missense	probably damaging	0.99
X0026:Scnn1a	UTSW	6	125322110	missense	probably damaging	1.00
Z1176:Scnn1a	UTSW	6	125343892	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATGCTTTGAGATGGGAAGGC -3'
(R):5'- TCATGTTCTCCTGGAAGCAG -3'

Sequencing Primer
(F):5'- GAAGGCTGGTGGACTGC -3'
(R):5'- TCCTGGAAGCAGGAGTGAATGC -3'

Posted On

2015-05-15