Incidental Mutation 'R4072:Scnn1a'
ID 316334
Institutional Source Beutler Lab
Gene Symbol Scnn1a
Ensembl Gene ENSMUSG00000030340
Gene Name sodium channel, nonvoltage-gated 1 alpha
Synonyms Scnn1, mENaC, ENaC alpha
MMRRC Submission 040854-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4072 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 125297622-125321906 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125315870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 407 (N407S)
Ref Sequence ENSEMBL: ENSMUSP00000134929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000081440
AA Change: N433S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: N433S

DomainStartEndE-ValueType
low complexity region 13 18 N/A INTRINSIC
Pfam:ASC 88 600 1.1e-93 PFAM
low complexity region 647 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175966
SMART Domains Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 62 264 3.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176110
AA Change: N407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: N407S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176442
AA Change: N326S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340
AA Change: N326S

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.3e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176655
AA Change: N326S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340
AA Change: N326S

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.4e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177329
AA Change: N407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: N407S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Meta Mutation Damage Score 0.3118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,922,342 (GRCm39) probably null Het
Abcc5 A G 16: 20,152,445 (GRCm39) I1367T probably damaging Het
Acsm4 T A 7: 119,297,981 (GRCm39) L206H probably benign Het
Acss3 C T 10: 106,959,446 (GRCm39) probably benign Het
Adam34l A T 8: 44,079,387 (GRCm39) F279Y probably damaging Het
Ankar G T 1: 72,727,751 (GRCm39) D169E probably damaging Het
Arfgap3 C T 15: 83,187,330 (GRCm39) A510T probably damaging Het
Atp4a T C 7: 30,414,757 (GRCm39) I182T probably benign Het
Axl A G 7: 25,463,336 (GRCm39) probably benign Het
Baz1a A G 12: 54,988,345 (GRCm39) I268T probably benign Het
Baz2b A T 2: 59,742,917 (GRCm39) probably null Het
C2cd4d C A 3: 94,271,185 (GRCm39) C150* probably null Het
Crtac1 T C 19: 42,293,146 (GRCm39) Y321C probably damaging Het
Dnah11 T C 12: 118,070,227 (GRCm39) H1526R probably damaging Het
Dnah5 A T 15: 28,340,444 (GRCm39) R2284* probably null Het
Dnah9 T C 11: 65,975,730 (GRCm39) T1440A probably benign Het
Eps15l1 A G 8: 73,134,128 (GRCm39) I482T probably damaging Het
Eqtn A G 4: 94,808,199 (GRCm39) I201T possibly damaging Het
Ercc4 G A 16: 12,948,549 (GRCm39) V499I probably damaging Het
Eva1c T A 16: 90,701,019 (GRCm39) F331Y probably damaging Het
Fcho1 T C 8: 72,163,013 (GRCm39) H672R probably damaging Het
Galntl5 A T 5: 25,403,478 (GRCm39) K150* probably null Het
Gm19965 A G 1: 116,748,801 (GRCm39) T161A probably benign Het
Hydin G A 8: 111,231,888 (GRCm39) E1617K possibly damaging Het
Krtap31-1 T C 11: 99,799,058 (GRCm39) I87T possibly damaging Het
Lamp3 A G 16: 19,519,466 (GRCm39) L239P possibly damaging Het
Nlrp4c A G 7: 6,075,709 (GRCm39) K667E probably benign Het
Obox3 G T 7: 15,359,724 (GRCm39) T315N possibly damaging Het
Obscn A G 11: 58,888,009 (GRCm39) I7652T unknown Het
Or52e18 A T 7: 104,609,923 (GRCm39) N5K probably damaging Het
Or5b3 G A 19: 13,388,299 (GRCm39) R122H possibly damaging Het
Or8u8 T A 2: 86,011,991 (GRCm39) M155L probably benign Het
Pde7a G A 3: 19,311,017 (GRCm39) R70C probably damaging Het
Pidd1 A G 7: 141,020,739 (GRCm39) F453L probably damaging Het
Pms2 T C 5: 143,865,819 (GRCm39) I742T probably damaging Het
Pot1a T C 6: 25,752,356 (GRCm39) probably null Het
Pramel33 A T 5: 93,633,057 (GRCm39) M50K probably damaging Het
Rp1l1 A T 14: 64,265,581 (GRCm39) E389V probably damaging Het
Slc30a7 T C 3: 115,740,329 (GRCm39) D374G probably damaging Het
Slco2a1 T A 9: 102,945,201 (GRCm39) I192N probably damaging Het
Srp72 C A 5: 77,146,098 (GRCm39) T633K probably benign Het
Tm2d3 T A 7: 65,347,498 (GRCm39) L49* probably null Het
Tmprss11e T C 5: 86,863,502 (GRCm39) T188A possibly damaging Het
Tox T C 4: 6,842,396 (GRCm39) T45A probably damaging Het
Usp31 A G 7: 121,267,005 (GRCm39) probably null Het
Vwc2 T A 11: 11,066,446 (GRCm39) L178Q probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb11 C T 16: 55,818,427 (GRCm39) T617I possibly damaging Het
Other mutations in Scnn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Scnn1a APN 6 125,315,342 (GRCm39) missense probably benign 0.11
IGL01793:Scnn1a APN 6 125,320,666 (GRCm39) missense probably benign 0.03
IGL01992:Scnn1a APN 6 125,315,900 (GRCm39) critical splice donor site probably null
IGL03280:Scnn1a APN 6 125,319,744 (GRCm39) splice site probably benign
scylla UTSW 6 125,320,208 (GRCm39) missense probably damaging 0.98
R0086:Scnn1a UTSW 6 125,319,550 (GRCm39) splice site probably benign
R0442:Scnn1a UTSW 6 125,316,100 (GRCm39) missense probably damaging 1.00
R0454:Scnn1a UTSW 6 125,299,189 (GRCm39) missense probably damaging 1.00
R0578:Scnn1a UTSW 6 125,299,207 (GRCm39) missense probably damaging 0.97
R1538:Scnn1a UTSW 6 125,315,856 (GRCm39) missense possibly damaging 0.48
R1579:Scnn1a UTSW 6 125,299,103 (GRCm39) missense probably damaging 1.00
R1803:Scnn1a UTSW 6 125,309,157 (GRCm39) missense probably damaging 0.98
R1876:Scnn1a UTSW 6 125,315,801 (GRCm39) missense probably benign 0.05
R2113:Scnn1a UTSW 6 125,314,774 (GRCm39) missense possibly damaging 0.60
R2178:Scnn1a UTSW 6 125,307,965 (GRCm39) missense probably damaging 0.96
R2960:Scnn1a UTSW 6 125,299,256 (GRCm39) missense probably damaging 1.00
R4603:Scnn1a UTSW 6 125,299,123 (GRCm39) missense probably damaging 1.00
R4928:Scnn1a UTSW 6 125,299,136 (GRCm39) missense probably damaging 1.00
R5436:Scnn1a UTSW 6 125,319,985 (GRCm39) missense possibly damaging 0.94
R6812:Scnn1a UTSW 6 125,314,819 (GRCm39) missense probably benign 0.09
R7089:Scnn1a UTSW 6 125,314,770 (GRCm39) missense probably benign 0.05
R8371:Scnn1a UTSW 6 125,320,806 (GRCm39) missense possibly damaging 0.83
R8372:Scnn1a UTSW 6 125,320,681 (GRCm39) missense probably damaging 0.96
R8841:Scnn1a UTSW 6 125,320,208 (GRCm39) missense probably damaging 0.98
R9509:Scnn1a UTSW 6 125,319,604 (GRCm39) missense probably damaging 0.99
X0026:Scnn1a UTSW 6 125,299,073 (GRCm39) missense probably damaging 1.00
Z1176:Scnn1a UTSW 6 125,320,855 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGCTTTGAGATGGGAAGGC -3'
(R):5'- TCATGTTCTCCTGGAAGCAG -3'

Sequencing Primer
(F):5'- GAAGGCTGGTGGACTGC -3'
(R):5'- TCCTGGAAGCAGGAGTGAATGC -3'
Posted On 2015-05-15