Incidental Mutation 'R4072:Nlrp4c'
ID316335
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene NameNLR family, pyrin domain containing 4C
SynonymsNalp-alpha, Rnh2, Nalp4c
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6045161-6105150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6072710 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 667 (K667E)
Ref Sequence ENSEMBL: ENSMUSP00000146613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
Predicted Effect probably benign
Transcript: ENSMUST00000037728
AA Change: K667E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: K667E

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121583
AA Change: K667E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: K667E

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207267
Predicted Effect probably benign
Transcript: ENSMUST00000208360
AA Change: K667E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6066702 missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6060656 missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6066112 nonsense probably null
IGL02087:Nlrp4c APN 7 6092583 missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6066829 missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6084648 missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6065727 missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6098952 missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6065975 missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6084680 missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6066416 missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6060845 missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6065943 missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6066778 missense probably benign
R1636:Nlrp4c UTSW 7 6066738 missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6073222 missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6073114 missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6066956 splice site probably null
R1827:Nlrp4c UTSW 7 6065766 missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6084656 missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6065819 missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6073114 missense probably benign
R2415:Nlrp4c UTSW 7 6066048 missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6065628 missense probably damaging 0.99
R4073:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6100827 nonsense probably null
R4709:Nlrp4c UTSW 7 6065425 missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6066126 missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6066825 missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6066623 missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6092508 missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6066053 missense probably benign
R6650:Nlrp4c UTSW 7 6065949 missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6066755 missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6060793 missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6065709 nonsense probably null
R7104:Nlrp4c UTSW 7 6065709 nonsense probably null
R7232:Nlrp4c UTSW 7 6065709 nonsense probably null
R7444:Nlrp4c UTSW 7 6092596 nonsense probably null
R7705:Nlrp4c UTSW 7 6072636 missense probably damaging 0.97
X0060:Nlrp4c UTSW 7 6065918 missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6066636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGAATGTATTTCTTTGTCCTC -3'
(R):5'- GAAGCCCTGCATACACTTTCATC -3'

Sequencing Primer
(F):5'- GTCCTCTGTTACAGGGAAAAGCTAC -3'
(R):5'- TTAGTGGTACCAAGCCAG -3'
Posted On2015-05-15