Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Tm2d3'

316340

Institutional Source

Beutler Lab

Gene Symbol

Tm2d3

Ensembl Gene

ENSMUSG00000078681

Gene Name

TM2 domain containing 3

Synonyms

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65691169-65701913 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 65697750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 49 (L49*)

Ref Sequence

ENSEMBL: ENSMUSP00000145545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032726] [ENSMUST00000065574] [ENSMUST00000107495] [ENSMUST00000129166] [ENSMUST00000143508] [ENSMUST00000206517] [ENSMUST00000206628] [ENSMUST00000206934]

AlphaFold

Q8BJ83

Predicted Effect

probably damaging
Transcript: ENSMUST00000032726
AA Change: C111S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032726
Gene: ENSMUSG00000078681
AA Change: C111S

Domain	Start	End	E-Value	Type
low complexity region	8	22	N/A	INTRINSIC
Pfam:TM2	165	214	5.1e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000065574
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064967
Gene: ENSMUSG00000078681
AA Change: C142S

Domain	Start	End	E-Value	Type
low complexity region	8	22	N/A	INTRINSIC
Pfam:TM2	196	245	6.3e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107495
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103119
Gene: ENSMUSG00000078681
AA Change: C142S

Domain	Start	End	E-Value	Type
low complexity region	8	22	N/A	INTRINSIC
Pfam:TM2	196	245	5e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000129166
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000143508

SMART Domains

Protein: ENSMUSP00000116848
Gene: ENSMUSG00000078681

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000206361
AA Change: C85S

Predicted Effect

probably damaging
Transcript: ENSMUST00000206517
AA Change: C133S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206628
AA Change: C113S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206837

Predicted Effect

probably null
Transcript: ENSMUST00000206934
AA Change: L49*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. Several alternatively spliced transcript variants of this gene are described but the full length nature of some variants has not been determined. Multiple polyadenylation sites have been found in this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Tm2d3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Tm2d3	APN	7	65695222	nonsense	probably null
IGL02312:Tm2d3	APN	7	65699169	critical splice donor site	probably null
topple	UTSW	7	65699124	missense	probably damaging	1.00
R0115:Tm2d3	UTSW	7	65695334	intron	probably benign
R0265:Tm2d3	UTSW	7	65697834	missense	possibly damaging	0.60
R2143:Tm2d3	UTSW	7	65695239	missense	probably damaging	1.00
R4074:Tm2d3	UTSW	7	65697750	nonsense	probably null
R4075:Tm2d3	UTSW	7	65697750	nonsense	probably null
R4076:Tm2d3	UTSW	7	65697750	nonsense	probably null
R4351:Tm2d3	UTSW	7	65695191	missense	probably damaging	1.00
R4966:Tm2d3	UTSW	7	65697721	missense	possibly damaging	0.81
R5381:Tm2d3	UTSW	7	65701672	missense	probably damaging	1.00
R5571:Tm2d3	UTSW	7	65699124	missense	probably damaging	1.00
R5621:Tm2d3	UTSW	7	65701618	missense	probably damaging	1.00
R6819:Tm2d3	UTSW	7	65697778	missense	probably damaging	1.00
R7168:Tm2d3	UTSW	7	65693926	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCGATGCTACATACGAGCCTTC -3'
(R):5'- CCAAGGGTCTTTCTGAGAACTG -3'

Sequencing Primer
(F):5'- ACGAGCCTTCTTCCTATATGAACTG -3'
(R):5'- CTCAAGTGTGGCTAAGGGCTC -3'

Posted On

2015-05-15