Incidental Mutation 'R4072:Acsm4'
ID 316342
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Name acyl-CoA synthetase medium-chain family member 4
Synonyms OMACS, O-MACS
MMRRC Submission 040854-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R4072 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119289249-119313788 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119297981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 206 (L206H)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
AlphaFold Q80W40
Predicted Effect probably benign
Transcript: ENSMUST00000047045
AA Change: L206H

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: L206H

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,922,342 (GRCm39) probably null Het
Abcc5 A G 16: 20,152,445 (GRCm39) I1367T probably damaging Het
Acss3 C T 10: 106,959,446 (GRCm39) probably benign Het
Adam34l A T 8: 44,079,387 (GRCm39) F279Y probably damaging Het
Ankar G T 1: 72,727,751 (GRCm39) D169E probably damaging Het
Arfgap3 C T 15: 83,187,330 (GRCm39) A510T probably damaging Het
Atp4a T C 7: 30,414,757 (GRCm39) I182T probably benign Het
Axl A G 7: 25,463,336 (GRCm39) probably benign Het
Baz1a A G 12: 54,988,345 (GRCm39) I268T probably benign Het
Baz2b A T 2: 59,742,917 (GRCm39) probably null Het
C2cd4d C A 3: 94,271,185 (GRCm39) C150* probably null Het
Crtac1 T C 19: 42,293,146 (GRCm39) Y321C probably damaging Het
Dnah11 T C 12: 118,070,227 (GRCm39) H1526R probably damaging Het
Dnah5 A T 15: 28,340,444 (GRCm39) R2284* probably null Het
Dnah9 T C 11: 65,975,730 (GRCm39) T1440A probably benign Het
Eps15l1 A G 8: 73,134,128 (GRCm39) I482T probably damaging Het
Eqtn A G 4: 94,808,199 (GRCm39) I201T possibly damaging Het
Ercc4 G A 16: 12,948,549 (GRCm39) V499I probably damaging Het
Eva1c T A 16: 90,701,019 (GRCm39) F331Y probably damaging Het
Fcho1 T C 8: 72,163,013 (GRCm39) H672R probably damaging Het
Galntl5 A T 5: 25,403,478 (GRCm39) K150* probably null Het
Gm19965 A G 1: 116,748,801 (GRCm39) T161A probably benign Het
Hydin G A 8: 111,231,888 (GRCm39) E1617K possibly damaging Het
Krtap31-1 T C 11: 99,799,058 (GRCm39) I87T possibly damaging Het
Lamp3 A G 16: 19,519,466 (GRCm39) L239P possibly damaging Het
Nlrp4c A G 7: 6,075,709 (GRCm39) K667E probably benign Het
Obox3 G T 7: 15,359,724 (GRCm39) T315N possibly damaging Het
Obscn A G 11: 58,888,009 (GRCm39) I7652T unknown Het
Or52e18 A T 7: 104,609,923 (GRCm39) N5K probably damaging Het
Or5b3 G A 19: 13,388,299 (GRCm39) R122H possibly damaging Het
Or8u8 T A 2: 86,011,991 (GRCm39) M155L probably benign Het
Pde7a G A 3: 19,311,017 (GRCm39) R70C probably damaging Het
Pidd1 A G 7: 141,020,739 (GRCm39) F453L probably damaging Het
Pms2 T C 5: 143,865,819 (GRCm39) I742T probably damaging Het
Pot1a T C 6: 25,752,356 (GRCm39) probably null Het
Pramel33 A T 5: 93,633,057 (GRCm39) M50K probably damaging Het
Rp1l1 A T 14: 64,265,581 (GRCm39) E389V probably damaging Het
Scnn1a A G 6: 125,315,870 (GRCm39) N407S probably damaging Het
Slc30a7 T C 3: 115,740,329 (GRCm39) D374G probably damaging Het
Slco2a1 T A 9: 102,945,201 (GRCm39) I192N probably damaging Het
Srp72 C A 5: 77,146,098 (GRCm39) T633K probably benign Het
Tm2d3 T A 7: 65,347,498 (GRCm39) L49* probably null Het
Tmprss11e T C 5: 86,863,502 (GRCm39) T188A possibly damaging Het
Tox T C 4: 6,842,396 (GRCm39) T45A probably damaging Het
Usp31 A G 7: 121,267,005 (GRCm39) probably null Het
Vwc2 T A 11: 11,066,446 (GRCm39) L178Q probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb11 C T 16: 55,818,427 (GRCm39) T617I possibly damaging Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119,310,642 (GRCm39) nonsense probably null
IGL01676:Acsm4 APN 7 119,307,866 (GRCm39) missense probably benign 0.00
IGL01801:Acsm4 APN 7 119,306,486 (GRCm39) missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119,293,075 (GRCm39) splice site probably null
IGL02220:Acsm4 APN 7 119,310,395 (GRCm39) missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119,309,907 (GRCm39) missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119,302,646 (GRCm39) splice site probably benign
I0000:Acsm4 UTSW 7 119,310,415 (GRCm39) missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119,297,798 (GRCm39) missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119,307,933 (GRCm39) missense probably benign 0.00
R1386:Acsm4 UTSW 7 119,297,801 (GRCm39) missense probably benign
R1433:Acsm4 UTSW 7 119,293,042 (GRCm39) missense probably damaging 0.99
R1961:Acsm4 UTSW 7 119,307,963 (GRCm39) missense probably benign 0.04
R3957:Acsm4 UTSW 7 119,302,588 (GRCm39) missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119,293,008 (GRCm39) missense probably benign
R4075:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4076:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4432:Acsm4 UTSW 7 119,310,610 (GRCm39) missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119,297,797 (GRCm39) missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119,297,900 (GRCm39) missense probably benign
R4992:Acsm4 UTSW 7 119,310,640 (GRCm39) missense probably benign 0.43
R5046:Acsm4 UTSW 7 119,302,597 (GRCm39) missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119,312,173 (GRCm39) missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119,294,023 (GRCm39) missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119,293,068 (GRCm39) missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119,310,622 (GRCm39) missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119,292,933 (GRCm39) missense probably benign 0.01
R7892:Acsm4 UTSW 7 119,293,889 (GRCm39) missense possibly damaging 0.48
R8716:Acsm4 UTSW 7 119,307,883 (GRCm39) missense probably damaging 1.00
R8738:Acsm4 UTSW 7 119,304,264 (GRCm39) missense probably benign 0.00
R9616:Acsm4 UTSW 7 119,293,872 (GRCm39) missense probably benign 0.01
Z1177:Acsm4 UTSW 7 119,310,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACGATCCAACTGACCAG -3'
(R):5'- CATCATAGGCCACAGAGGAG -3'

Sequencing Primer
(F):5'- GAAAAGACATCCTCTACCGGCTG -3'
(R):5'- CAGAGGACATATGTTCAATCCCTGG -3'
Posted On 2015-05-15