Incidental Mutation 'R4072:Eps15l1'
ID316347
Institutional Source Beutler Lab
Gene Symbol Eps15l1
Ensembl Gene ENSMUSG00000006276
Gene Nameepidermal growth factor receptor pathway substrate 15-like 1
Synonyms9830147J04Rik, Eps15-rs, Eps15R
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72340999-72421460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72380284 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 482 (I482T)
Ref Sequence ENSEMBL: ENSMUSP00000148468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163643] [ENSMUST00000212121] [ENSMUST00000212590]
Predicted Effect probably damaging
Transcript: ENSMUST00000163643
AA Change: I482T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276
AA Change: I482T

DomainStartEndE-ValueType
EH 8 103 1.45e-21 SMART
EFh 52 80 6.56e0 SMART
EH 120 214 6.1e-47 SMART
EFh 163 191 4.35e-2 SMART
low complexity region 241 255 N/A INTRINSIC
EH 266 362 5.08e-44 SMART
EFh 276 304 1.09e0 SMART
coiled coil region 381 564 N/A INTRINSIC
internal_repeat_2 615 656 1.56e-6 PROSPERO
low complexity region 661 678 N/A INTRINSIC
low complexity region 701 722 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
low complexity region 775 790 N/A INTRINSIC
internal_repeat_2 809 839 1.56e-6 PROSPERO
low complexity region 840 853 N/A INTRINSIC
UIM 863 882 3.98e1 SMART
UIM 889 907 3.76e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212121
AA Change: I482T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212590
AA Change: I482T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212950
Meta Mutation Damage Score 0.1266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Eps15l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Eps15l1 APN 8 72384838 nonsense probably null
IGL01316:Eps15l1 APN 8 72389414 missense possibly damaging 0.66
IGL01344:Eps15l1 APN 8 72382325 critical splice donor site probably null
IGL01918:Eps15l1 APN 8 72367912 missense possibly damaging 0.49
IGL01982:Eps15l1 APN 8 72379075 missense probably benign 0.28
IGL02305:Eps15l1 APN 8 72387009 missense probably null 1.00
IGL02939:Eps15l1 APN 8 72384762 splice site probably benign
IGL02951:Eps15l1 APN 8 72358396 missense probably benign 0.19
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0799:Eps15l1 UTSW 8 72346085 missense probably damaging 0.99
R1300:Eps15l1 UTSW 8 72391902 missense probably damaging 0.99
R2131:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2132:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2133:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R3693:Eps15l1 UTSW 8 72399060 splice site probably benign
R4074:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4076:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4485:Eps15l1 UTSW 8 72399687 missense possibly damaging 0.78
R4592:Eps15l1 UTSW 8 72341394 missense probably damaging 0.96
R4606:Eps15l1 UTSW 8 72373916 missense possibly damaging 0.69
R4981:Eps15l1 UTSW 8 72378989 critical splice donor site probably null
R5496:Eps15l1 UTSW 8 72382775 missense probably benign 0.00
R5502:Eps15l1 UTSW 8 72378992 intron probably null
R5682:Eps15l1 UTSW 8 72371748 nonsense probably null
R6326:Eps15l1 UTSW 8 72341434 nonsense probably null
R6384:Eps15l1 UTSW 8 72368710 critical splice donor site probably null
R7305:Eps15l1 UTSW 8 72373034 missense probably benign
R7500:Eps15l1 UTSW 8 72382790 missense probably damaging 1.00
R7732:Eps15l1 UTSW 8 72380976 missense probably damaging 1.00
Z1088:Eps15l1 UTSW 8 72386901 missense probably damaging 0.99
Z1177:Eps15l1 UTSW 8 72373078 critical splice acceptor site probably null
Z1177:Eps15l1 UTSW 8 72381437 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GATGTCATCCTGTGTGCACTTC -3'
(R):5'- TGGCTATGCAGACTCCTTATG -3'

Sequencing Primer
(F):5'- ATCCTGTGTGCACTTCAGGGAC -3'
(R):5'- CTATGCAGACTCCTTATGCTTTATAC -3'
Posted On2015-05-15