Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Eps15l1'

316347

Institutional Source

Beutler Lab

Gene Symbol

Eps15l1

Ensembl Gene

ENSMUSG00000006276

Gene Name

epidermal growth factor receptor pathway substrate 15-like 1

Synonyms

9830147J04Rik, Eps15-rs, Eps15R

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72340999-72421460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72380284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 482 (I482T)

Ref Sequence

ENSEMBL: ENSMUSP00000148468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163643] [ENSMUST00000212121] [ENSMUST00000212590]

AlphaFold

Q60902

Predicted Effect

probably damaging
Transcript: ENSMUST00000163643
AA Change: I482T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276
AA Change: I482T

Domain	Start	End	E-Value	Type
EH	8	103	1.45e-21	SMART
EFh	52	80	6.56e0	SMART
EH	120	214	6.1e-47	SMART
EFh	163	191	4.35e-2	SMART
low complexity region	241	255	N/A	INTRINSIC
EH	266	362	5.08e-44	SMART
EFh	276	304	1.09e0	SMART
coiled coil region	381	564	N/A	INTRINSIC
internal_repeat_2	615	656	1.56e-6	PROSPERO
low complexity region	661	678	N/A	INTRINSIC
low complexity region	701	722	N/A	INTRINSIC
low complexity region	728	743	N/A	INTRINSIC
low complexity region	746	764	N/A	INTRINSIC
low complexity region	775	790	N/A	INTRINSIC
internal_repeat_2	809	839	1.56e-6	PROSPERO
low complexity region	840	853	N/A	INTRINSIC
UIM	863	882	3.98e1	SMART
UIM	889	907	3.76e2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212121
AA Change: I482T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212590
AA Change: I482T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212950

Meta Mutation Damage Score

0.1266

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Eps15l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Eps15l1	APN	8	72384838	nonsense	probably null
IGL01316:Eps15l1	APN	8	72389414	missense	possibly damaging	0.66
IGL01344:Eps15l1	APN	8	72382325	critical splice donor site	probably null
IGL01918:Eps15l1	APN	8	72367912	missense	possibly damaging	0.49
IGL01982:Eps15l1	APN	8	72379075	missense	probably benign	0.28
IGL02305:Eps15l1	APN	8	72387009	missense	probably null	1.00
IGL02939:Eps15l1	APN	8	72384762	splice site	probably benign
IGL02951:Eps15l1	APN	8	72358396	missense	probably benign	0.19
R0025:Eps15l1	UTSW	8	72381497	splice site	probably benign
R0025:Eps15l1	UTSW	8	72381497	splice site	probably benign
R0030:Eps15l1	UTSW	8	72373050	missense	probably benign	0.03
R0030:Eps15l1	UTSW	8	72373050	missense	probably benign	0.03
R0799:Eps15l1	UTSW	8	72346085	missense	probably damaging	0.99
R1300:Eps15l1	UTSW	8	72391902	missense	probably damaging	0.99
R2131:Eps15l1	UTSW	8	72386868	missense	probably benign	0.05
R2132:Eps15l1	UTSW	8	72386868	missense	probably benign	0.05
R2133:Eps15l1	UTSW	8	72386868	missense	probably benign	0.05
R3693:Eps15l1	UTSW	8	72399060	splice site	probably benign
R4074:Eps15l1	UTSW	8	72380284	missense	probably damaging	1.00
R4076:Eps15l1	UTSW	8	72380284	missense	probably damaging	1.00
R4485:Eps15l1	UTSW	8	72399687	missense	possibly damaging	0.78
R4592:Eps15l1	UTSW	8	72341394	missense	probably damaging	0.96
R4606:Eps15l1	UTSW	8	72373916	missense	possibly damaging	0.69
R4981:Eps15l1	UTSW	8	72378989	critical splice donor site	probably null
R5496:Eps15l1	UTSW	8	72382775	missense	probably benign	0.00
R5502:Eps15l1	UTSW	8	72378992	splice site	probably null
R5682:Eps15l1	UTSW	8	72371748	nonsense	probably null
R6326:Eps15l1	UTSW	8	72341434	nonsense	probably null
R6384:Eps15l1	UTSW	8	72368710	critical splice donor site	probably null
R7305:Eps15l1	UTSW	8	72373034	missense	probably benign
R7500:Eps15l1	UTSW	8	72382790	missense	probably damaging	1.00
R7732:Eps15l1	UTSW	8	72380976	missense	probably damaging	1.00
R8980:Eps15l1	UTSW	8	72373890	missense	probably benign	0.00
R9065:Eps15l1	UTSW	8	72391918	nonsense	probably null
R9238:Eps15l1	UTSW	8	72341430	missense	probably damaging	1.00
Z1088:Eps15l1	UTSW	8	72386901	missense	probably damaging	0.99
Z1177:Eps15l1	UTSW	8	72373078	critical splice acceptor site	probably null
Z1177:Eps15l1	UTSW	8	72381437	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GATGTCATCCTGTGTGCACTTC -3'
(R):5'- TGGCTATGCAGACTCCTTATG -3'

Sequencing Primer
(F):5'- ATCCTGTGTGCACTTCAGGGAC -3'
(R):5'- CTATGCAGACTCCTTATGCTTTATAC -3'

Posted On

2015-05-15