Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Slco2a1'

316349

Institutional Source

Beutler Lab

Gene Symbol

Slco2a1

Ensembl Gene

ENSMUSG00000032548

Gene Name

solute carrier organic anion transporter family, member 2a1

Synonyms

Pgt, mPgt, 2310021C19Rik, Slc21a2

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102988712-103096002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103068002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 192 (I192N)

Ref Sequence

ENSEMBL: ENSMUSP00000140533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035148] [ENSMUST00000188664]

AlphaFold

Q9EPT5

Predicted Effect

probably damaging
Transcript: ENSMUST00000035148
AA Change: I192N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035148
Gene: ENSMUSG00000032548
AA Change: I192N

Domain	Start	End	E-Value	Type
Pfam:MFS_1	39	428	3.5e-22	PFAM
KAZAL	446	493	2.78e-2	SMART
transmembrane domain	605	627	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000188664
AA Change: I192N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140533
Gene: ENSMUSG00000032548
AA Change: I192N

Domain	Start	End	E-Value	Type
Pfam:OATP	31	381	4.8e-135	PFAM
Pfam:MFS_1	39	413	1.8e-19	PFAM

Meta Mutation Damage Score

0.6254

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preinatel or early psotnatal lethality due to a patent ductus arteriosus and abnormal protaglandin metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Slco2a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Slco2a1	APN	9	103079441	splice site	probably benign
IGL01481:Slco2a1	APN	9	103070251	missense	probably damaging	1.00
IGL01647:Slco2a1	APN	9	103070296	missense	possibly damaging	0.57
IGL01885:Slco2a1	APN	9	103074430	missense	probably damaging	1.00
IGL02150:Slco2a1	APN	9	103084818	missense	probably damaging	1.00
IGL02508:Slco2a1	APN	9	103074416	missense	probably benign
IGL02578:Slco2a1	APN	9	103046758	missense	probably damaging	1.00
IGL02622:Slco2a1	APN	9	103076929	nonsense	probably null
IGL02898:Slco2a1	APN	9	103079606	missense	probably damaging	1.00
IGL03101:Slco2a1	APN	9	103077006	missense	possibly damaging	0.69
PIT4431001:Slco2a1	UTSW	9	103050268	missense	probably damaging	1.00
R0410:Slco2a1	UTSW	9	103073314	critical splice donor site	probably null
R0831:Slco2a1	UTSW	9	103082334	missense	probably damaging	0.99
R0885:Slco2a1	UTSW	9	103082383	missense	probably damaging	0.98
R1975:Slco2a1	UTSW	9	103079454	nonsense	probably null
R2095:Slco2a1	UTSW	9	103076968	missense	probably benign	0.22
R4105:Slco2a1	UTSW	9	103067876	missense	probably benign	0.01
R4105:Slco2a1	UTSW	9	103073250	missense	probably damaging	1.00
R4804:Slco2a1	UTSW	9	103073184	missense	probably damaging	1.00
R4881:Slco2a1	UTSW	9	103085832	missense	possibly damaging	0.71
R5073:Slco2a1	UTSW	9	103046726	missense	probably damaging	1.00
R5124:Slco2a1	UTSW	9	103050166	missense	probably damaging	1.00
R5147:Slco2a1	UTSW	9	103050269	missense	probably damaging	1.00
R5317:Slco2a1	UTSW	9	103079579	missense	probably benign	0.01
R5363:Slco2a1	UTSW	9	103070263	missense	probably damaging	0.99
R5381:Slco2a1	UTSW	9	103068014	missense	probably damaging	1.00
R5732:Slco2a1	UTSW	9	103050256	missense	probably damaging	1.00
R5736:Slco2a1	UTSW	9	103067830	missense	probably benign	0.00
R5924:Slco2a1	UTSW	9	103046699	nonsense	probably null
R5945:Slco2a1	UTSW	9	103046790	missense	probably damaging	1.00
R6293:Slco2a1	UTSW	9	103050147	missense	probably benign	0.30
R6386:Slco2a1	UTSW	9	103076988	missense	probably benign
R6622:Slco2a1	UTSW	9	103074505	missense	possibly damaging	0.84
R7325:Slco2a1	UTSW	9	103085749	splice site	probably null
R7484:Slco2a1	UTSW	9	103067986	missense	probably damaging	1.00
R8395:Slco2a1	UTSW	9	103077040	missense	probably benign	0.12
R8985:Slco2a1	UTSW	9	103072635	critical splice donor site	probably null
R9127:Slco2a1	UTSW	9	103068044	missense	probably damaging	1.00
R9141:Slco2a1	UTSW	9	103068055	splice site	probably benign
R9620:Slco2a1	UTSW	9	103084866	missense	probably damaging	1.00
R9695:Slco2a1	UTSW	9	103084940	missense	possibly damaging	0.80
Z1088:Slco2a1	UTSW	9	103079527	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTACTGGGCATGCTCATTGC -3'
(R):5'- AGCAGAACTGGCATTAACAATG -3'

Sequencing Primer
(F):5'- GCTCATTGCAGGAAACAGC -3'
(R):5'- AACAATGGGTCTTTGTCATCCAC -3'

Posted On

2015-05-15