Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Acss3'

316350

Institutional Source

Beutler Lab

Gene Symbol

Acss3

Ensembl Gene

ENSMUSG00000035948

Gene Name

acyl-CoA synthetase short-chain family member 3

Synonyms

LOC380660, 8430416H19Rik

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106933517-107123668 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 107123585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044668] [ENSMUST00000165067]

AlphaFold

Q14DH7

Predicted Effect

probably benign
Transcript: ENSMUST00000044668

SMART Domains

Protein: ENSMUSP00000040823
Gene: ENSMUSG00000035948

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	112	496	4.6e-67	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000065567

Predicted Effect

probably benign
Transcript: ENSMUST00000165067

SMART Domains

Protein: ENSMUSP00000128209
Gene: ENSMUSG00000035948

Domain	Start	End	E-Value	Type
Pfam:ACAS_N	57	111	8.8e-22	PFAM
Pfam:AMP-binding	113	557	3.2e-81	PFAM
Pfam:AMP-binding_C	565	644	2.2e-22	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Acss3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Acss3	APN	10	106966026	missense	probably benign
IGL00941:Acss3	APN	10	107053326	critical splice donor site	probably null
IGL00983:Acss3	APN	10	106966964	nonsense	probably null
IGL01010:Acss3	APN	10	107023849	splice site	probably benign
IGL02227:Acss3	APN	10	107045335	missense	probably benign
IGL02296:Acss3	APN	10	107053451	nonsense	probably null
IGL02319:Acss3	APN	10	106948750	missense	probably damaging	0.99
IGL03181:Acss3	APN	10	107053388	missense	probably damaging	1.00
R0032:Acss3	UTSW	10	107123295	missense	probably benign	0.13
R0032:Acss3	UTSW	10	107123295	missense	probably benign	0.13
R0279:Acss3	UTSW	10	107084871	missense	possibly damaging	0.95
R0418:Acss3	UTSW	10	107023912	missense	probably damaging	0.99
R0550:Acss3	UTSW	10	107053471	missense	probably damaging	1.00
R1114:Acss3	UTSW	10	106988879	missense	possibly damaging	0.89
R1491:Acss3	UTSW	10	106937308	missense	probably benign
R1625:Acss3	UTSW	10	106937402	critical splice donor site	probably null
R1771:Acss3	UTSW	10	106937200	missense	probably damaging	1.00
R1956:Acss3	UTSW	10	106936168	missense	probably benign	0.00
R2006:Acss3	UTSW	10	106963010	missense	possibly damaging	0.81
R2018:Acss3	UTSW	10	106936207	missense	probably benign	0.00
R2019:Acss3	UTSW	10	106936207	missense	probably benign	0.00
R2078:Acss3	UTSW	10	106967041	missense	possibly damaging	0.94
R2253:Acss3	UTSW	10	107004748	missense	probably damaging	1.00
R2391:Acss3	UTSW	10	107123487	missense	probably benign	0.00
R3082:Acss3	UTSW	10	107023715	missense	possibly damaging	0.94
R3083:Acss3	UTSW	10	107023715	missense	possibly damaging	0.94
R4086:Acss3	UTSW	10	107053452	missense	probably damaging	1.00
R4087:Acss3	UTSW	10	107053452	missense	probably damaging	1.00
R4089:Acss3	UTSW	10	107053452	missense	probably damaging	1.00
R4090:Acss3	UTSW	10	107053452	missense	probably damaging	1.00
R4406:Acss3	UTSW	10	107053337	missense	probably damaging	1.00
R4607:Acss3	UTSW	10	106967029	missense	possibly damaging	0.88
R4608:Acss3	UTSW	10	106967029	missense	possibly damaging	0.88
R4790:Acss3	UTSW	10	107023702	nonsense	probably null
R4834:Acss3	UTSW	10	107084805	critical splice donor site	probably null
R5130:Acss3	UTSW	10	107004725	missense	possibly damaging	0.87
R5303:Acss3	UTSW	10	107084851	missense	possibly damaging	0.74
R5365:Acss3	UTSW	10	107004728	missense	probably damaging	1.00
R5439:Acss3	UTSW	10	106937147	nonsense	probably null
R5617:Acss3	UTSW	10	106951990	missense	probably damaging	1.00
R5698:Acss3	UTSW	10	106948744	missense	probably damaging	1.00
R5726:Acss3	UTSW	10	107123322	missense	possibly damaging	0.63
R6154:Acss3	UTSW	10	107123349	missense	probably benign	0.02
R6298:Acss3	UTSW	10	107084856	missense	probably damaging	1.00
R6592:Acss3	UTSW	10	107023718	missense	possibly damaging	0.94
R6707:Acss3	UTSW	10	107084922	missense	probably damaging	1.00
R6999:Acss3	UTSW	10	107053501	missense	probably damaging	1.00
R7567:Acss3	UTSW	10	107123313	missense	probably benign	0.00
R8351:Acss3	UTSW	10	107049404	missense	probably damaging	0.98
R8451:Acss3	UTSW	10	107049404	missense	probably damaging	0.98
R8515:Acss3	UTSW	10	106948663	missense	possibly damaging	0.51
R8917:Acss3	UTSW	10	106937263	missense	probably benign
R8972:Acss3	UTSW	10	107084922	missense	probably damaging	1.00
R9308:Acss3	UTSW	10	107123421	missense	possibly damaging	0.93
R9387:Acss3	UTSW	10	107123394	missense	probably damaging	0.99
R9801:Acss3	UTSW	10	107045230	missense	possibly damaging	0.85
X0027:Acss3	UTSW	10	107123344	missense	probably benign	0.05
Z1177:Acss3	UTSW	10	107004777	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTACCCCAGAATCTTTCGGG -3'
(R):5'- GCTTTCTTGCTGACTCCAGG -3'

Sequencing Primer
(F):5'- AGAATCTTTCGGGGTCAGCCAC -3'
(R):5'- CCAGGTCGGTTTTTATCGCAGAC -3'

Posted On

2015-05-15