Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Arfgap3'

316359

Institutional Source

Beutler Lab

Gene Symbol

Arfgap3

Ensembl Gene

ENSMUSG00000054277

Gene Name

ADP-ribosylation factor GTPase activating protein 3

Synonyms

1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299739-83350247 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83303129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 510 (A510T)

Ref Sequence

ENSEMBL: ENSMUSP00000154712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124] [ENSMUST00000226764]

AlphaFold

Q9D8S3

Predicted Effect

probably damaging
Transcript: ENSMUST00000067215
AA Change: A511T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: A511T

Domain	Start	End	E-Value	Type
ArfGap	10	126	7.18e-44	SMART
Blast:ArfGap	160	200	2e-6	BLAST
low complexity region	220	237	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
low complexity region	459	466	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000226124
AA Change: A510T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226411

Predicted Effect

probably damaging
Transcript: ENSMUST00000226764
AA Change: A63T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226816

Meta Mutation Damage Score

0.7507

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Arfgap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00908:Arfgap3	APN	15	83322589	missense	probably benign	0.04
IGL01306:Arfgap3	APN	15	83313509	missense	possibly damaging	0.78
IGL01960:Arfgap3	APN	15	83313557	missense	probably benign	0.04
IGL03029:Arfgap3	APN	15	83322650	missense	probably damaging	1.00
IGL03036:Arfgap3	APN	15	83306926	missense	possibly damaging	0.91
IGL03328:Arfgap3	APN	15	83343081	missense	probably damaging	1.00
ANU23:Arfgap3	UTSW	15	83313509	missense	possibly damaging	0.78
R0103:Arfgap3	UTSW	15	83322721	splice site	probably benign
R0103:Arfgap3	UTSW	15	83322721	splice site	probably benign
R0125:Arfgap3	UTSW	15	83343139	missense	probably benign	0.01
R0243:Arfgap3	UTSW	15	83330513	splice site	probably benign
R0551:Arfgap3	UTSW	15	83343137	missense	probably damaging	1.00
R0557:Arfgap3	UTSW	15	83303185	missense	probably damaging	1.00
R0638:Arfgap3	UTSW	15	83308188	splice site	probably null
R1115:Arfgap3	UTSW	15	83330540	missense	probably benign	0.00
R1459:Arfgap3	UTSW	15	83306937	missense	probably benign	0.15
R1576:Arfgap3	UTSW	15	83313563	missense	possibly damaging	0.94
R1776:Arfgap3	UTSW	15	83343139	missense	probably benign	0.01
R1826:Arfgap3	UTSW	15	83303102	critical splice donor site	probably null
R2057:Arfgap3	UTSW	15	83310300	missense	probably benign
R2084:Arfgap3	UTSW	15	83334566	missense	probably damaging	0.96
R3407:Arfgap3	UTSW	15	83322607	missense	probably benign	0.00
R4074:Arfgap3	UTSW	15	83303129	missense	probably damaging	1.00
R4206:Arfgap3	UTSW	15	83322668	missense	probably benign
R4449:Arfgap3	UTSW	15	83334558	missense	probably damaging	1.00
R5004:Arfgap3	UTSW	15	83310296	missense	possibly damaging	0.87
R5193:Arfgap3	UTSW	15	83332697	missense	probably benign	0.01
R5364:Arfgap3	UTSW	15	83314361	missense	probably damaging	1.00
R6142:Arfgap3	UTSW	15	83350127	missense	probably damaging	1.00
R6813:Arfgap3	UTSW	15	83330593	missense	probably benign	0.00
R7154:Arfgap3	UTSW	15	83336704	missense	probably damaging	1.00
R7422:Arfgap3	UTSW	15	83306949	missense	probably damaging	0.97
R7582:Arfgap3	UTSW	15	83303101	missense	possibly damaging	0.77
R7714:Arfgap3	UTSW	15	83308151	missense	probably benign	0.34
R8269:Arfgap3	UTSW	15	83310341	missense	probably benign	0.01
R9352:Arfgap3	UTSW	15	83306926	missense	possibly damaging	0.82
R9712:Arfgap3	UTSW	15	83313533	missense	probably benign	0.02
R9729:Arfgap3	UTSW	15	83308165	missense	probably damaging	1.00
Z1177:Arfgap3	UTSW	15	83332688	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATACGAACTCCAGTAGGAACTTAG -3'
(R):5'- CACAACTGATGCCTGGAAGG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- CCTGGAAGGAGGCAAGAGAGTAG -3'

Posted On

2015-05-15