Incidental Mutation 'R4072:Ercc4'
ID316360
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 4
SynonymsXpf
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13109684-13150617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13130685 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 499 (V499I)
Ref Sequence ENSEMBL: ENSMUSP00000114639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049] [ENSMUST00000141024]
Predicted Effect probably damaging
Transcript: ENSMUST00000023206
AA Change: V589I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: V589I

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000129049
AA Change: V499I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000141024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156393
Meta Mutation Damage Score 0.2922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 13125369 missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 13122004 missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 13132934 missense probably damaging 1.00
IGL02406:Ercc4 APN 16 13123536 missense probably damaging 1.00
IGL03248:Ercc4 APN 16 13127593 missense probably damaging 1.00
Rascal UTSW 16 13132947 missense probably damaging 1.00
PIT4812001:Ercc4 UTSW 16 13144447 missense probably benign 0.29
R0212:Ercc4 UTSW 16 13123332 critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 13126467 missense probably benign
R0962:Ercc4 UTSW 16 13130146 missense probably damaging 0.99
R1078:Ercc4 UTSW 16 13130197 missense probably benign 0.00
R1356:Ercc4 UTSW 16 13125282 missense probably damaging 0.99
R1420:Ercc4 UTSW 16 13130209 missense probably benign 0.01
R1554:Ercc4 UTSW 16 13147622 missense probably damaging 1.00
R1899:Ercc4 UTSW 16 13147787 missense probably damaging 1.00
R2128:Ercc4 UTSW 16 13147934 missense probably damaging 0.99
R2214:Ercc4 UTSW 16 13110024 missense probably damaging 1.00
R3757:Ercc4 UTSW 16 13144496 missense probably benign 0.28
R4073:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4075:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4076:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4646:Ercc4 UTSW 16 13147574 missense probably damaging 1.00
R4731:Ercc4 UTSW 16 13147607 missense probably damaging 1.00
R4756:Ercc4 UTSW 16 13123423 missense probably damaging 1.00
R4767:Ercc4 UTSW 16 13122095 missense probably damaging 1.00
R5011:Ercc4 UTSW 16 13123581 intron probably benign
R5013:Ercc4 UTSW 16 13123581 intron probably benign
R5301:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R5308:Ercc4 UTSW 16 13130164 missense probably damaging 1.00
R5684:Ercc4 UTSW 16 13130601 missense probably benign 0.35
R6083:Ercc4 UTSW 16 13110039 nonsense probably null
R6092:Ercc4 UTSW 16 13125261 missense probably benign 0.04
R6815:Ercc4 UTSW 16 13123435 missense probably damaging 0.99
R6953:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R7062:Ercc4 UTSW 16 13132947 missense probably damaging 1.00
R7199:Ercc4 UTSW 16 13147793 missense probably damaging 1.00
R7317:Ercc4 UTSW 16 13122113 missense probably benign 0.12
R7858:Ercc4 UTSW 16 13125305 missense probably damaging 0.98
R7941:Ercc4 UTSW 16 13125305 missense probably damaging 0.98
R7948:Ercc4 UTSW 16 13130185 missense probably benign 0.00
RF007:Ercc4 UTSW 16 13123507 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGACAGACCAGTAGTAGCCC -3'
(R):5'- TCCATCTGGAACGTTCTATCG -3'

Sequencing Primer
(F):5'- GGTAGAGATTAAGCGTGAATCATTTG -3'
(R):5'- GTTCTATCGTTCACCAGAAAGCAG -3'
Posted On2015-05-15