Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Lamp3'

316361

Institutional Source

Beutler Lab

Gene Symbol

Lamp3

Ensembl Gene

ENSMUSG00000041247

Gene Name

lysosomal-associated membrane protein 3

Synonyms

Cd208, DC-LAMP, 1200002D17Rik, TSC403

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19653378-19706375 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19700716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 239 (L239P)

Ref Sequence

ENSEMBL: ENSMUSP00000080556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081880]

AlphaFold

Q7TST5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081880
AA Change: L239P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080556
Gene: ENSMUSG00000041247
AA Change: L239P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Lamp	103	411	5.6e-75	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]).[supplied by OMIM, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Lamp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01901:Lamp3	APN	16	19673419	missense	probably damaging	1.00
IGL02505:Lamp3	APN	16	19655457	missense	possibly damaging	0.48
IGL02892:Lamp3	APN	16	19676052	missense	probably damaging	1.00
IGL03228:Lamp3	APN	16	19676067	missense	possibly damaging	0.94
PIT4453001:Lamp3	UTSW	16	19673460	missense	probably benign	0.14
R0295:Lamp3	UTSW	16	19701108	nonsense	probably null
R0419:Lamp3	UTSW	16	19673552	missense	probably damaging	1.00
R1568:Lamp3	UTSW	16	19673525	missense	probably damaging	1.00
R1702:Lamp3	UTSW	16	19676072	missense	probably benign	0.11
R2018:Lamp3	UTSW	16	19701211	missense	probably benign	0.02
R2019:Lamp3	UTSW	16	19701211	missense	probably benign	0.02
R4073:Lamp3	UTSW	16	19700716	missense	possibly damaging	0.89
R4075:Lamp3	UTSW	16	19700716	missense	possibly damaging	0.89
R4076:Lamp3	UTSW	16	19700716	missense	possibly damaging	0.89
R4333:Lamp3	UTSW	16	19673436	missense	probably benign	0.02
R4457:Lamp3	UTSW	16	19673529	missense	probably benign	0.19
R4868:Lamp3	UTSW	16	19701290	missense	probably benign	0.01
R4876:Lamp3	UTSW	16	19655470	missense	probably damaging	0.97
R5766:Lamp3	UTSW	16	19701317	missense	probably damaging	0.99
R5832:Lamp3	UTSW	16	19701320	missense	probably damaging	0.98
R5997:Lamp3	UTSW	16	19701028	missense	probably benign	0.22
R6000:Lamp3	UTSW	16	19700948	missense	possibly damaging	0.88
R6088:Lamp3	UTSW	16	19673398	missense	probably damaging	1.00
R6332:Lamp3	UTSW	16	19699681	missense	probably damaging	1.00
R6636:Lamp3	UTSW	16	19701233	missense	probably benign
R6637:Lamp3	UTSW	16	19701233	missense	probably benign
R6881:Lamp3	UTSW	16	19699618	missense	probably benign	0.39
R6966:Lamp3	UTSW	16	19699653	nonsense	probably null
R7002:Lamp3	UTSW	16	19655422	missense	possibly damaging	0.89
R7067:Lamp3	UTSW	16	19699663	missense	probably damaging	0.99
R7425:Lamp3	UTSW	16	19699612	critical splice donor site	probably null
R7781:Lamp3	UTSW	16	19699690	missense	possibly damaging	0.86
R7866:Lamp3	UTSW	16	19699740	missense	probably benign	0.01
R7894:Lamp3	UTSW	16	19655391	missense	probably damaging	1.00
R7912:Lamp3	UTSW	16	19655497	missense	probably damaging	1.00
R8036:Lamp3	UTSW	16	19701059	missense	probably damaging	1.00
R8776:Lamp3	UTSW	16	19655502	missense	probably damaging	1.00
R8776-TAIL:Lamp3	UTSW	16	19655502	missense	probably damaging	1.00
R8836:Lamp3	UTSW	16	19701038	missense	probably benign	0.16
R9314:Lamp3	UTSW	16	19673442	missense	probably benign	0.06
R9533:Lamp3	UTSW	16	19701058	missense	probably benign	0.02
R9544:Lamp3	UTSW	16	19676082	critical splice acceptor site	probably null
R9588:Lamp3	UTSW	16	19676082	critical splice acceptor site	probably null
R9689:Lamp3	UTSW	16	19699705	missense	possibly damaging	0.95
RF018:Lamp3	UTSW	16	19701250	missense	probably benign
X0025:Lamp3	UTSW	16	19701056	missense	possibly damaging	0.82
X0063:Lamp3	UTSW	16	19700885	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTGGCTCCAAGTAAGAAGTATAC -3'
(R):5'- GGCCAACTCTGTCCACTAATG -3'

Sequencing Primer
(F):5'- GTATACATGTTGAAGTTCTCCTTGC -3'
(R):5'- ACTCTGTCCACTAATGTCTTAGGAAC -3'

Posted On

2015-05-15