Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Abcc5'

316362

Institutional Source

Beutler Lab

Gene Symbol

Abcc5

Ensembl Gene

ENSMUSG00000022822

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 5

Synonyms

2900011L11Rik, Abcc5a, Mrp5, Abcc5b

MMRRC Submission

040854-MU

Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20331303-20426394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20333695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1367 (I1367T)

Ref Sequence

ENSEMBL: ENSMUSP00000111209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547]

AlphaFold

Q9R1X5

Predicted Effect

probably damaging
Transcript: ENSMUST00000079158
AA Change: I1367T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: I1367T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	179	447	1.6e-18	PFAM
low complexity region	552	563	N/A	INTRINSIC
AAA	587	760	1.16e-12	SMART
low complexity region	815	826	N/A	INTRINSIC
Pfam:ABC_membrane	858	1142	9.3e-36	PFAM
AAA	1218	1403	1.26e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115547
AA Change: I1367T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: I1367T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	179	447	2e-17	PFAM
low complexity region	552	563	N/A	INTRINSIC
AAA	587	760	1.16e-12	SMART
low complexity region	815	826	N/A	INTRINSIC
Pfam:ABC_membrane	858	1146	6.5e-30	PFAM
AAA	1218	1403	1.26e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134413

Meta Mutation Damage Score

0.6817

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]

Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Abcc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Abcc5	APN	16	20422357	missense	probably benign	0.01
IGL00928:Abcc5	APN	16	20398970	unclassified	probably benign
IGL01350:Abcc5	APN	16	20368458	missense	probably benign	0.00
IGL01774:Abcc5	APN	16	20378457	missense	probably damaging	1.00
IGL01934:Abcc5	APN	16	20422441	utr 5 prime	probably benign
IGL02413:Abcc5	APN	16	20422437	utr 5 prime	probably benign
IGL02426:Abcc5	APN	16	20338925	missense	probably damaging	0.98
IGL02797:Abcc5	APN	16	20368464	missense	probably benign	0.06
IGL02938:Abcc5	APN	16	20362229	missense	possibly damaging	0.64
IGL03367:Abcc5	APN	16	20392811	utr 3 prime	probably benign
IGL03411:Abcc5	APN	16	20399560	missense	probably damaging	0.97
PIT4508001:Abcc5	UTSW	16	20357378	missense	probably damaging	0.97
R0021:Abcc5	UTSW	16	20378661	nonsense	probably null
R0021:Abcc5	UTSW	16	20378661	nonsense	probably null
R0220:Abcc5	UTSW	16	20369102	missense	probably benign
R0281:Abcc5	UTSW	16	20422400	missense	probably damaging	1.00
R0401:Abcc5	UTSW	16	20376558	missense	probably benign	0.09
R0448:Abcc5	UTSW	16	20399937	missense	probably damaging	1.00
R0477:Abcc5	UTSW	16	20368569	missense	possibly damaging	0.51
R0477:Abcc5	UTSW	16	20398885	missense	probably damaging	0.96
R0601:Abcc5	UTSW	16	20404559	splice site	probably benign
R0648:Abcc5	UTSW	16	20365882	missense	possibly damaging	0.90
R0709:Abcc5	UTSW	16	20376592	missense	possibly damaging	0.91
R1144:Abcc5	UTSW	16	20422438	utr 5 prime	probably benign
R1552:Abcc5	UTSW	16	20398867	missense	probably damaging	0.99
R1625:Abcc5	UTSW	16	20365817	missense	probably damaging	0.99
R1748:Abcc5	UTSW	16	20333588	missense	probably benign	0.01
R1789:Abcc5	UTSW	16	20365951	missense	probably damaging	1.00
R1801:Abcc5	UTSW	16	20338887	missense	probably benign	0.43
R1909:Abcc5	UTSW	16	20376509	critical splice donor site	probably null
R2046:Abcc5	UTSW	16	20399817	missense	possibly damaging	0.90
R2203:Abcc5	UTSW	16	20405882	missense	possibly damaging	0.91
R3031:Abcc5	UTSW	16	20375113	missense	probably damaging	0.99
R3417:Abcc5	UTSW	16	20405552	splice site	probably benign
R3708:Abcc5	UTSW	16	20372180	missense	probably benign	0.30
R3731:Abcc5	UTSW	16	20398934	nonsense	probably null
R3829:Abcc5	UTSW	16	20365865	missense	probably benign	0.00
R3847:Abcc5	UTSW	16	20372156	missense	probably benign	0.12
R3850:Abcc5	UTSW	16	20372156	missense	probably benign	0.12
R3955:Abcc5	UTSW	16	20405543	missense	probably damaging	0.97
R4432:Abcc5	UTSW	16	20368187	splice site	probably null
R4433:Abcc5	UTSW	16	20368187	splice site	probably null
R4505:Abcc5	UTSW	16	20333695	missense	probably damaging	1.00
R4506:Abcc5	UTSW	16	20333695	missense	probably damaging	1.00
R4715:Abcc5	UTSW	16	20398876	missense	probably damaging	1.00
R4739:Abcc5	UTSW	16	20399626	missense	probably damaging	1.00
R4866:Abcc5	UTSW	16	20422432	start codon destroyed	probably null	1.00
R4905:Abcc5	UTSW	16	20399928	missense	probably damaging	1.00
R4907:Abcc5	UTSW	16	20376546	missense	possibly damaging	0.86
R5088:Abcc5	UTSW	16	20376662	missense	probably damaging	1.00
R5232:Abcc5	UTSW	16	20338922	missense	probably damaging	0.96
R5559:Abcc5	UTSW	16	20338886	missense	probably damaging	1.00
R5647:Abcc5	UTSW	16	20399847	missense	probably damaging	1.00
R5861:Abcc5	UTSW	16	20399894	missense	probably damaging	1.00
R6190:Abcc5	UTSW	16	20392779	missense	probably benign	0.02
R6213:Abcc5	UTSW	16	20400012	missense	probably damaging	1.00
R6511:Abcc5	UTSW	16	20376594	missense	probably damaging	0.99
R6732:Abcc5	UTSW	16	20404684	missense	probably benign	0.01
R6815:Abcc5	UTSW	16	20333630	missense	probably damaging	1.00
R6913:Abcc5	UTSW	16	20378744	missense	possibly damaging	0.73
R6945:Abcc5	UTSW	16	20400009	missense	probably benign
R7167:Abcc5	UTSW	16	20405501	missense	possibly damaging	0.70
R7276:Abcc5	UTSW	16	20376508	splice site	probably null
R7318:Abcc5	UTSW	16	20392543	missense	probably benign	0.01
R7380:Abcc5	UTSW	16	20397034	missense	possibly damaging	0.84
R7419:Abcc5	UTSW	16	20422423	missense	possibly damaging	0.57
R7451:Abcc5	UTSW	16	20375070	missense	probably damaging	1.00
R7475:Abcc5	UTSW	16	20399989	missense	probably benign	0.04
R7567:Abcc5	UTSW	16	20405510	missense	probably damaging	1.00
R7601:Abcc5	UTSW	16	20375132	nonsense	probably null
R7623:Abcc5	UTSW	16	20344696	missense	possibly damaging	0.95
R7682:Abcc5	UTSW	16	20368053	missense	probably damaging	1.00
R8128:Abcc5	UTSW	16	20365723	missense	probably damaging	0.98
R8327:Abcc5	UTSW	16	20422318	missense	probably benign	0.00
R8518:Abcc5	UTSW	16	20404648	missense	possibly damaging	0.80
R8678:Abcc5	UTSW	16	20365935	missense	probably benign	0.31
R8679:Abcc5	UTSW	16	20333729	missense	possibly damaging	0.89
R9206:Abcc5	UTSW	16	20389389	missense	probably benign	0.00
R9254:Abcc5	UTSW	16	20333687	missense	probably damaging	1.00
R9379:Abcc5	UTSW	16	20333687	missense	probably damaging	1.00
R9501:Abcc5	UTSW	16	20396103	missense	probably damaging	1.00
R9647:Abcc5	UTSW	16	20376560	missense	probably benign	0.01
X0022:Abcc5	UTSW	16	20392587	missense	probably damaging	1.00
X0053:Abcc5	UTSW	16	20364042	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATGGCTGCTTGGTGAATGCC -3'
(R):5'- CACGTCCATGTGAAACAGTACATC -3'

Sequencing Primer
(F):5'- TGAAGATGACAGGTAGCCCCTC -3'
(R):5'- TCCATGTGAAACAGTACATCGTACAG -3'

Posted On

2015-05-15