Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Zbtb11'

316363

Institutional Source

Beutler Lab

Gene Symbol

Zbtb11

Ensembl Gene

ENSMUSG00000022601

Gene Name

zinc finger and BTB domain containing 11

Synonyms

ZNF-U69274, 9230110G02Rik

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55973883-56008913 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55998064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 617 (T617I)

Ref Sequence

ENSEMBL: ENSMUSP00000056923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050248]

AlphaFold

G5E8B9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050248
AA Change: T617I

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: T617I

Domain	Start	End	E-Value	Type
low complexity region	136	158	N/A	INTRINSIC
low complexity region	161	177	N/A	INTRINSIC
BTB	214	312	4.77e-13	SMART
low complexity region	371	399	N/A	INTRINSIC
ZnF_C2H2	566	588	1.1e-2	SMART
ZnF_C2H2	594	616	2.09e-3	SMART
low complexity region	623	640	N/A	INTRINSIC
ZnF_C2H2	648	670	4.47e-3	SMART
ZnF_C2H2	676	698	8.22e-2	SMART
ZnF_C2H2	704	726	2.27e-4	SMART
ZnF_C2H2	732	754	1.28e-3	SMART
ZnF_C2H2	763	785	2.95e-3	SMART
ZnF_C2H2	791	813	7.67e-2	SMART
ZnF_C2H2	819	843	2.95e-3	SMART
ZnF_C2H2	855	877	1.67e-2	SMART
ZnF_C2H2	883	905	3.02e0	SMART
ZnF_C2H2	911	934	9.58e-3	SMART
low complexity region	979	994	N/A	INTRINSIC

Meta Mutation Damage Score

0.0866

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het

Other mutations in Zbtb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Zbtb11	APN	16	56000602	nonsense	probably null
IGL01107:Zbtb11	APN	16	56006007	missense	probably damaging	1.00
IGL01341:Zbtb11	APN	16	55990931	missense	possibly damaging	0.68
IGL01510:Zbtb11	APN	16	55990343	missense	probably damaging	0.99
IGL01611:Zbtb11	APN	16	55980610	missense	probably damaging	1.00
IGL01736:Zbtb11	APN	16	55998160	missense	probably damaging	1.00
IGL01834:Zbtb11	APN	16	55991008	missense	probably benign	0.35
IGL02427:Zbtb11	APN	16	55982350	missense	possibly damaging	0.95
IGL02441:Zbtb11	APN	16	55974189	missense	possibly damaging	0.94
IGL02455:Zbtb11	APN	16	56000675	missense	probably damaging	1.00
PIT4544001:Zbtb11	UTSW	16	55998193	nonsense	probably null
R0987:Zbtb11	UTSW	16	55990708	missense	probably benign	0.00
R1414:Zbtb11	UTSW	16	55990560	nonsense	probably null
R1437:Zbtb11	UTSW	16	55991620	critical splice donor site	probably null
R1570:Zbtb11	UTSW	16	55990815	missense	probably benign
R1658:Zbtb11	UTSW	16	55974225	missense	possibly damaging	0.71
R1735:Zbtb11	UTSW	16	55990682	missense	probably benign
R2048:Zbtb11	UTSW	16	55998009	missense	probably damaging	1.00
R2925:Zbtb11	UTSW	16	55974084	missense	probably benign	0.00
R4075:Zbtb11	UTSW	16	55998064	missense	possibly damaging	0.89
R4076:Zbtb11	UTSW	16	55998064	missense	possibly damaging	0.89
R5023:Zbtb11	UTSW	16	56006065	missense	probably damaging	1.00
R5755:Zbtb11	UTSW	16	56000713	missense	probably benign	0.02
R5757:Zbtb11	UTSW	16	56007029	missense	probably damaging	1.00
R6218:Zbtb11	UTSW	16	55998073	missense	probably benign	0.00
R6313:Zbtb11	UTSW	16	55990491	missense	probably benign	0.03
R6461:Zbtb11	UTSW	16	56006871	missense	probably damaging	0.99
R6666:Zbtb11	UTSW	16	56006252	missense	probably damaging	1.00
R6807:Zbtb11	UTSW	16	55990502	missense	probably benign	0.03
R7194:Zbtb11	UTSW	16	56007188	missense	probably damaging	1.00
R7424:Zbtb11	UTSW	16	55990487	missense	probably benign	0.01
R8022:Zbtb11	UTSW	16	56006020	missense	probably damaging	0.99
R8436:Zbtb11	UTSW	16	56000659	nonsense	probably null
R8532:Zbtb11	UTSW	16	55990889	missense	probably benign	0.03
R8806:Zbtb11	UTSW	16	55982274	missense	probably damaging	1.00
R9033:Zbtb11	UTSW	16	55998129	missense	probably benign
R9673:Zbtb11	UTSW	16	56006973	missense	probably damaging	1.00
RF014:Zbtb11	UTSW	16	55980597	missense	probably damaging	0.97
Z1176:Zbtb11	UTSW	16	55991502	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTCATATACCCTTGGCTGTG -3'
(R):5'- TTACACCCGTGTGCTTTAGC -3'

Sequencing Primer
(F):5'- CATATACCCTTGGCTGTGTTTTGCG -3'
(R):5'- GTTCTTCCCTTCTCAGATGA -3'

Posted On

2015-05-15