Incidental Mutation 'R4072:Zbtb11'
ID316363
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Namezinc finger and BTB domain containing 11
SynonymsZNF-U69274, 9230110G02Rik
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55973883-56008913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55998064 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 617 (T617I)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050248
AA Change: T617I

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: T617I

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 56000602 nonsense probably null
IGL01107:Zbtb11 APN 16 56006007 missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55990931 missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55990343 missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55980610 missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55998160 missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55991008 missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55982350 missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55974189 missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 56000675 missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55998193 nonsense probably null
R0987:Zbtb11 UTSW 16 55990708 missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55990560 nonsense probably null
R1437:Zbtb11 UTSW 16 55991620 critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55990815 missense probably benign
R1658:Zbtb11 UTSW 16 55974225 missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55990682 missense probably benign
R2048:Zbtb11 UTSW 16 55998009 missense probably damaging 1.00
R2925:Zbtb11 UTSW 16 55974084 missense probably benign 0.00
R4075:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 56006065 missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 56000713 missense probably benign 0.02
R5757:Zbtb11 UTSW 16 56007029 missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55998073 missense probably benign 0.00
R6313:Zbtb11 UTSW 16 55990491 missense probably benign 0.03
R6461:Zbtb11 UTSW 16 56006871 missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 56006252 missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55990502 missense probably benign 0.03
R7194:Zbtb11 UTSW 16 56007188 missense probably damaging 1.00
R7424:Zbtb11 UTSW 16 55990487 missense probably benign 0.01
R8022:Zbtb11 UTSW 16 56006020 missense probably damaging 0.99
R8436:Zbtb11 UTSW 16 56000659 nonsense probably null
R8532:Zbtb11 UTSW 16 55990889 missense probably benign 0.03
R8806:Zbtb11 UTSW 16 55982274 missense probably damaging 1.00
RF014:Zbtb11 UTSW 16 55980597 missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55991502 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTTCATATACCCTTGGCTGTG -3'
(R):5'- TTACACCCGTGTGCTTTAGC -3'

Sequencing Primer
(F):5'- CATATACCCTTGGCTGTGTTTTGCG -3'
(R):5'- GTTCTTCCCTTCTCAGATGA -3'
Posted On2015-05-15