Incidental Mutation 'R4072:Crtac1'
ID 316366
Institutional Source Beutler Lab
Gene Symbol Crtac1
Ensembl Gene ENSMUSG00000042401
Gene Name cartilage acidic protein 1
Synonyms Lotus, Crtac1B, 2810454P21Rik
MMRRC Submission 040854-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.531) question?
Stock # R4072 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 42283037-42431783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42304707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 321 (Y321C)
Ref Sequence ENSEMBL: ENSMUSP00000044858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048630]
AlphaFold Q8R555
Predicted Effect probably damaging
Transcript: ENSMUST00000048630
AA Change: Y321C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: Y321C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:VCBS 63 133 6.6e-12 PFAM
Pfam:VCBS 254 311 2e-12 PFAM
Pfam:VCBS 300 364 4.9e-13 PFAM
low complexity region 403 417 N/A INTRINSIC
Pfam:UnbV_ASPIC 459 528 8.9e-18 PFAM
Pfam:EGF_CA 560 606 2.1e-13 PFAM
low complexity region 630 646 N/A INTRINSIC
Meta Mutation Damage Score 0.6874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Crtac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Crtac1 APN 19 42323794 missense probably damaging 1.00
IGL01296:Crtac1 APN 19 42284213 missense probably damaging 1.00
IGL01991:Crtac1 APN 19 42414121 missense possibly damaging 0.96
IGL02811:Crtac1 APN 19 42333911 missense probably damaging 1.00
R1957:Crtac1 UTSW 19 42287944 missense possibly damaging 0.79
R2046:Crtac1 UTSW 19 42334053 missense probably damaging 1.00
R2125:Crtac1 UTSW 19 42323732 missense probably damaging 1.00
R2280:Crtac1 UTSW 19 42283567 missense unknown
R2281:Crtac1 UTSW 19 42283567 missense unknown
R3508:Crtac1 UTSW 19 42304741 missense probably benign 0.09
R3923:Crtac1 UTSW 19 42333947 missense probably damaging 1.00
R4798:Crtac1 UTSW 19 42323801 missense possibly damaging 0.93
R4951:Crtac1 UTSW 19 42414131 missense probably benign
R4965:Crtac1 UTSW 19 42318740 missense probably damaging 1.00
R5190:Crtac1 UTSW 19 42333908 missense possibly damaging 0.50
R5579:Crtac1 UTSW 19 42304806 missense probably damaging 1.00
R5595:Crtac1 UTSW 19 42413951 missense probably benign 0.08
R5739:Crtac1 UTSW 19 42302173 missense probably damaging 1.00
R5872:Crtac1 UTSW 19 42309190 splice site probably null
R5936:Crtac1 UTSW 19 42323837 missense probably damaging 1.00
R6149:Crtac1 UTSW 19 42283609 missense unknown
R6193:Crtac1 UTSW 19 42323797 missense possibly damaging 0.47
R6858:Crtac1 UTSW 19 42318735 missense possibly damaging 0.93
R7246:Crtac1 UTSW 19 42287926 missense probably benign
R7726:Crtac1 UTSW 19 42302251 nonsense probably null
R7991:Crtac1 UTSW 19 42333960 missense probably benign 0.24
R8046:Crtac1 UTSW 19 42309053 splice site probably benign
R8071:Crtac1 UTSW 19 42297800 missense probably damaging 1.00
R8350:Crtac1 UTSW 19 42309186 missense probably damaging 1.00
R8450:Crtac1 UTSW 19 42309186 missense probably damaging 1.00
R9756:Crtac1 UTSW 19 42298341 missense probably damaging 1.00
R9766:Crtac1 UTSW 19 42414118 missense possibly damaging 0.96
X0018:Crtac1 UTSW 19 42309114 missense probably damaging 1.00
Z1176:Crtac1 UTSW 19 42287926 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTACCTTGGAGGATTCTC -3'
(R):5'- ACCTTCTCTTGTTGCTGGAG -3'

Sequencing Primer
(F):5'- ACCTGGATCCCTGCATGTTG -3'
(R):5'- CTGGAGGTGAATGTTTATGGAAC -3'
Posted On 2015-05-15