Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Crtac1'

316366

Institutional Source

Beutler Lab

Gene Symbol

Crtac1

Ensembl Gene

ENSMUSG00000042401

Gene Name

cartilage acidic protein 1

Synonyms

Lotus, Crtac1B, 2810454P21Rik

MMRRC Submission

040854-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42283037-42431783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42304707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 321 (Y321C)

Ref Sequence

ENSEMBL: ENSMUSP00000044858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048630]

AlphaFold

Q8R555

Predicted Effect

probably damaging
Transcript: ENSMUST00000048630
AA Change: Y321C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: Y321C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:VCBS	63	133	6.6e-12	PFAM
Pfam:VCBS	254	311	2e-12	PFAM
Pfam:VCBS	300	364	4.9e-13	PFAM
low complexity region	403	417	N/A	INTRINSIC
Pfam:UnbV_ASPIC	459	528	8.9e-18	PFAM
Pfam:EGF_CA	560	606	2.1e-13	PFAM
low complexity region	630	646	N/A	INTRINSIC

Meta Mutation Damage Score

0.6874

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Crtac1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Crtac1	APN	19	42323794	missense	probably damaging	1.00
IGL01296:Crtac1	APN	19	42284213	missense	probably damaging	1.00
IGL01991:Crtac1	APN	19	42414121	missense	possibly damaging	0.96
IGL02811:Crtac1	APN	19	42333911	missense	probably damaging	1.00
R1957:Crtac1	UTSW	19	42287944	missense	possibly damaging	0.79
R2046:Crtac1	UTSW	19	42334053	missense	probably damaging	1.00
R2125:Crtac1	UTSW	19	42323732	missense	probably damaging	1.00
R2280:Crtac1	UTSW	19	42283567	missense	unknown
R2281:Crtac1	UTSW	19	42283567	missense	unknown
R3508:Crtac1	UTSW	19	42304741	missense	probably benign	0.09
R3923:Crtac1	UTSW	19	42333947	missense	probably damaging	1.00
R4798:Crtac1	UTSW	19	42323801	missense	possibly damaging	0.93
R4951:Crtac1	UTSW	19	42414131	missense	probably benign
R4965:Crtac1	UTSW	19	42318740	missense	probably damaging	1.00
R5190:Crtac1	UTSW	19	42333908	missense	possibly damaging	0.50
R5579:Crtac1	UTSW	19	42304806	missense	probably damaging	1.00
R5595:Crtac1	UTSW	19	42413951	missense	probably benign	0.08
R5739:Crtac1	UTSW	19	42302173	missense	probably damaging	1.00
R5872:Crtac1	UTSW	19	42309190	splice site	probably null
R5936:Crtac1	UTSW	19	42323837	missense	probably damaging	1.00
R6149:Crtac1	UTSW	19	42283609	missense	unknown
R6193:Crtac1	UTSW	19	42323797	missense	possibly damaging	0.47
R6858:Crtac1	UTSW	19	42318735	missense	possibly damaging	0.93
R7246:Crtac1	UTSW	19	42287926	missense	probably benign
R7726:Crtac1	UTSW	19	42302251	nonsense	probably null
R7991:Crtac1	UTSW	19	42333960	missense	probably benign	0.24
R8046:Crtac1	UTSW	19	42309053	splice site	probably benign
R8071:Crtac1	UTSW	19	42297800	missense	probably damaging	1.00
R8350:Crtac1	UTSW	19	42309186	missense	probably damaging	1.00
R8450:Crtac1	UTSW	19	42309186	missense	probably damaging	1.00
R9756:Crtac1	UTSW	19	42298341	missense	probably damaging	1.00
R9766:Crtac1	UTSW	19	42414118	missense	possibly damaging	0.96
X0018:Crtac1	UTSW	19	42309114	missense	probably damaging	1.00
Z1176:Crtac1	UTSW	19	42287926	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGCTACCTTGGAGGATTCTC -3'
(R):5'- ACCTTCTCTTGTTGCTGGAG -3'

Sequencing Primer
(F):5'- ACCTGGATCCCTGCATGTTG -3'
(R):5'- CTGGAGGTGAATGTTTATGGAAC -3'

Posted On

2015-05-15