Incidental Mutation 'R4073:Zbbx'
ID316378
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4073 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75105671 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 151 (G151E)
Ref Sequence ENSEMBL: ENSMUSP00000103405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039269
AA Change: G151E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107775
AA Change: G151E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Pfam:zf-B_box 12 58 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107776
AA Change: G151E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Blast:BBOX 13 58 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107778
AA Change: G151E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: G151E

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Cbs C T 17: 31,633,005 C8Y possibly damaging Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nrm T A 17: 35,861,532 probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc28a3 T C 13: 58,559,290 I565V probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Spink12 A G 18: 44,104,664 N3S possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R8110:Zbbx UTSW 3 75155442 missense possibly damaging 0.58
R8367:Zbbx UTSW 3 75081727 critical splice donor site probably null
Z1177:Zbbx UTSW 3 75071783 critical splice acceptor site probably null
Z1177:Zbbx UTSW 3 75105684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAATCTCCCTTGGGAAGCTCTAG -3'
(R):5'- TGAGCCAACCATTTATAACTGC -3'

Sequencing Primer
(F):5'- CCCTTGGGAAGCTCTAGCAAATTG -3'
(R):5'- TCATGTCCTGATAAGATGCAGG -3'
Posted On2015-05-15