Mutagenetix > Incidental Mutation

Incidental Mutation 'R4073:Mtor'

316386

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

flat, 2610315D21Rik, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP, Frap1

MMRRC Submission

041621-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4073 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148533068-148642140 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 148633832 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2342 (S2342T)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

AlphaFold

Q9JLN9

Predicted Effect

probably damaging
Transcript: ENSMUST00000103221
AA Change: S2342T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: S2342T

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129715

Meta Mutation Damage Score

0.6660

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415M13Rik	C	T	17: 54,031,494 (GRCm39)		noncoding transcript	Het
Alox12	T	C	11: 70,138,136 (GRCm39)	N400D	probably damaging	Het
Axl	A	G	7: 25,463,336 (GRCm39)		probably benign	Het
Cbs	C	T	17: 31,851,979 (GRCm39)	C8Y	possibly damaging	Het
Ccdc103	C	T	11: 102,774,925 (GRCm39)	R175W	probably damaging	Het
Clasp1	T	C	1: 118,431,578 (GRCm39)	F171L	probably damaging	Het
Cnot10	A	G	9: 114,452,015 (GRCm39)	F254L	possibly damaging	Het
Cytl1	A	G	5: 37,892,940 (GRCm39)	I17V	unknown	Het
Dnah11	A	G	12: 118,009,413 (GRCm39)	M2083T	probably benign	Het
Dock7	A	T	4: 98,896,296 (GRCm39)	S768R	probably benign	Het
Egf	C	T	3: 129,529,618 (GRCm39)	R264Q	probably benign	Het
Ehhadh	T	C	16: 21,585,257 (GRCm39)	D208G	probably benign	Het
Eqtn	A	G	4: 94,808,199 (GRCm39)	I201T	possibly damaging	Het
Erbin	T	C	13: 103,996,619 (GRCm39)	E211G	probably damaging	Het
Ercc4	G	A	16: 12,948,549 (GRCm39)	V499I	probably damaging	Het
Gpd2	A	G	2: 57,180,025 (GRCm39)	R91G	probably damaging	Het
Herc1	A	G	9: 66,325,774 (GRCm39)	D1416G	probably benign	Het
Ighv1-30	C	T	12: 114,781,021 (GRCm39)		noncoding transcript	Het
Il23r	A	G	6: 67,463,106 (GRCm39)	I129T	probably damaging	Het
Jph4	T	C	14: 55,352,497 (GRCm39)	S79G	probably benign	Het
Lamp3	A	G	16: 19,519,466 (GRCm39)	L239P	possibly damaging	Het
Lrig3	C	T	10: 125,849,277 (GRCm39)	T999I	probably benign	Het
Lrrc71	G	A	3: 87,652,569 (GRCm39)	T185I	probably benign	Het
Mroh1	A	G	15: 76,292,185 (GRCm39)	D219G	probably benign	Het
Nf2	T	C	11: 4,798,958 (GRCm39)	S10G	probably benign	Het
Nlrp4c	A	G	7: 6,075,709 (GRCm39)	K667E	probably benign	Het
Nrm	T	A	17: 36,172,424 (GRCm39)		probably benign	Het
Nsd1	T	A	13: 55,395,541 (GRCm39)	H1047Q	probably benign	Het
Obox3	G	T	7: 15,359,724 (GRCm39)	T315N	possibly damaging	Het
Or2t47	T	C	11: 58,442,888 (GRCm39)	Y59C	probably damaging	Het
Or4k5	A	G	14: 50,385,500 (GRCm39)	V277A	possibly damaging	Het
Or4x13	T	C	2: 90,231,337 (GRCm39)	F111L	probably benign	Het
Or5b3	G	A	19: 13,388,299 (GRCm39)	R122H	possibly damaging	Het
Or6aa1	T	A	7: 86,044,155 (GRCm39)	I184F	probably damaging	Het
Or8b38	T	C	9: 37,973,165 (GRCm39)	L183P	probably damaging	Het
Pbx3	T	C	2: 34,114,424 (GRCm39)	Y112C	probably damaging	Het
Pde11a	C	T	2: 76,168,242 (GRCm39)	R237H	probably damaging	Het
Phactr1	ACTT	A	13: 43,213,245 (GRCm39)		probably benign	Het
Pidd1	A	G	7: 141,020,739 (GRCm39)	F453L	probably damaging	Het
Ptgs1	C	T	2: 36,127,788 (GRCm39)	R116C	probably damaging	Het
Rab39b	T	C	X: 74,618,658 (GRCm39)		probably benign	Het
Rpp25	T	C	9: 57,411,592 (GRCm39)	S25P	probably benign	Het
Rrbp1	T	G	2: 143,805,030 (GRCm39)	Q1045P	probably benign	Het
Sbk3	G	T	7: 4,973,501 (GRCm39)	A41D	probably damaging	Het
Slc24a3	T	A	2: 145,455,636 (GRCm39)		probably benign	Het
Slc28a3	T	C	13: 58,707,104 (GRCm39)	I565V	probably benign	Het
Slc35a3	T	C	3: 116,468,887 (GRCm39)	T275A	probably benign	Het
Spink12	A	G	18: 44,237,731 (GRCm39)	N3S	possibly damaging	Het
Srp72	C	A	5: 77,146,098 (GRCm39)	T633K	probably benign	Het
Tab3	G	T	X: 84,658,063 (GRCm39)	V197F	probably damaging	Het
Taf2	A	G	15: 54,915,633 (GRCm39)	L431P	probably damaging	Het
Tas2r131	A	T	6: 132,934,802 (GRCm39)	Y2*	probably null	Het
Tmprss11e	T	C	5: 86,863,502 (GRCm39)	T188A	possibly damaging	Het
Trpv1	T	C	11: 73,141,606 (GRCm39)	V175A	probably damaging	Het
Usp21	T	C	1: 171,109,746 (GRCm39)		probably benign	Het
Vmn1r25	A	G	6: 57,955,572 (GRCm39)	V239A	possibly damaging	Het
Zbbx	C	T	3: 75,012,978 (GRCm39)	G151E	probably damaging	Het
Zfhx4	G	T	3: 5,464,384 (GRCm39)	C1514F	probably damaging	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148,537,494 (GRCm39)	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148,615,214 (GRCm39)	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148,556,494 (GRCm39)	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148,599,308 (GRCm39)	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148,569,111 (GRCm39)	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148,615,070 (GRCm39)	splice site	probably benign
IGL02015:Mtor	APN	4	148,624,570 (GRCm39)	nonsense	probably null
IGL02084:Mtor	APN	4	148,555,137 (GRCm39)	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148,628,998 (GRCm39)	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148,634,302 (GRCm39)	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148,622,758 (GRCm39)	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148,619,396 (GRCm39)	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148,576,104 (GRCm39)	missense	probably benign	0.04
IGL02440:Mtor	APN	4	148,630,886 (GRCm39)	missense	probably benign	0.24
IGL02449:Mtor	APN	4	148,618,378 (GRCm39)	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148,555,041 (GRCm39)	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148,576,069 (GRCm39)	splice site	probably benign
IGL02904:Mtor	APN	4	148,536,851 (GRCm39)	missense	possibly damaging	0.55
IGL02931:Mtor	APN	4	148,549,421 (GRCm39)	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148,630,847 (GRCm39)	splice site	probably benign
IGL03133:Mtor	APN	4	148,568,776 (GRCm39)	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148,538,356 (GRCm39)	missense	probably benign	0.00
Brushes	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
Dynamo	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
engine	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
Erg	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
Lindor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
motor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
Vigor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
Vim	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148,608,957 (GRCm39)	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148,549,406 (GRCm39)	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0103:Mtor	UTSW	4	148,618,359 (GRCm39)	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148,565,380 (GRCm39)	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148,549,428 (GRCm39)	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148,549,432 (GRCm39)	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0330:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0365:Mtor	UTSW	4	148,570,507 (GRCm39)	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148,622,817 (GRCm39)	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148,624,907 (GRCm39)	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148,553,837 (GRCm39)	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148,610,503 (GRCm39)	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148,568,811 (GRCm39)	nonsense	probably null
R0710:Mtor	UTSW	4	148,548,848 (GRCm39)	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148,570,513 (GRCm39)	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148,634,645 (GRCm39)	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148,624,456 (GRCm39)	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148,623,287 (GRCm39)	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148,554,764 (GRCm39)	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148,575,871 (GRCm39)	nonsense	probably null
R1465:Mtor	UTSW	4	148,610,450 (GRCm39)	splice site	probably benign
R1506:Mtor	UTSW	4	148,620,962 (GRCm39)	splice site	probably benign
R1624:Mtor	UTSW	4	148,632,133 (GRCm39)	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148,623,364 (GRCm39)	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148,547,349 (GRCm39)	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148,637,546 (GRCm39)	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148,565,336 (GRCm39)	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148,539,089 (GRCm39)	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148,552,730 (GRCm39)	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148,550,482 (GRCm39)	missense	probably benign	0.00
R2054:Mtor	UTSW	4	148,547,309 (GRCm39)	missense	probably benign	0.05
R2099:Mtor	UTSW	4	148,634,649 (GRCm39)	nonsense	probably null
R2148:Mtor	UTSW	4	148,540,469 (GRCm39)	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148,623,327 (GRCm39)	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148,574,012 (GRCm39)	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148,614,948 (GRCm39)	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148,621,209 (GRCm39)	missense	probably benign	0.03
R4273:Mtor	UTSW	4	148,634,609 (GRCm39)	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148,570,576 (GRCm39)	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
R4942:Mtor	UTSW	4	148,556,599 (GRCm39)	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148,610,209 (GRCm39)	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
R5215:Mtor	UTSW	4	148,538,440 (GRCm39)	missense	probably benign
R5249:Mtor	UTSW	4	148,548,189 (GRCm39)	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148,550,549 (GRCm39)	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148,624,821 (GRCm39)	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148,630,901 (GRCm39)	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148,539,165 (GRCm39)	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148,575,927 (GRCm39)	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148,622,733 (GRCm39)	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148,553,463 (GRCm39)	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148,630,882 (GRCm39)	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148,620,993 (GRCm39)	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148,623,284 (GRCm39)	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148,621,892 (GRCm39)	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148,605,794 (GRCm39)	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148,610,552 (GRCm39)	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148,550,384 (GRCm39)	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148,635,457 (GRCm39)	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148,536,824 (GRCm39)	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148,623,004 (GRCm39)	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148,543,112 (GRCm39)	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148,634,641 (GRCm39)	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148,622,938 (GRCm39)	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148,573,955 (GRCm39)	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148,621,209 (GRCm39)	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148,608,930 (GRCm39)	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148,548,932 (GRCm39)	missense	probably benign
R7271:Mtor	UTSW	4	148,630,942 (GRCm39)	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148,640,801 (GRCm39)	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148,549,416 (GRCm39)	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148,547,252 (GRCm39)	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148,536,807 (GRCm39)	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148,624,765 (GRCm39)	nonsense	probably null
R7737:Mtor	UTSW	4	148,623,195 (GRCm39)	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148,547,397 (GRCm39)	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148,630,856 (GRCm39)	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148,552,744 (GRCm39)	missense	probably benign
R8928:Mtor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
R9040:Mtor	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
R9116:Mtor	UTSW	4	148,637,198 (GRCm39)	missense	probably benign
R9284:Mtor	UTSW	4	148,543,537 (GRCm39)	missense	probably benign	0.03
R9310:Mtor	UTSW	4	148,553,834 (GRCm39)	missense	probably benign	0.03
R9374:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9417:Mtor	UTSW	4	148,622,776 (GRCm39)	nonsense	probably null
R9465:Mtor	UTSW	4	148,624,839 (GRCm39)	missense	possibly damaging	0.92
R9492:Mtor	UTSW	4	148,568,801 (GRCm39)	missense	probably damaging	1.00
R9499:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9516:Mtor	UTSW	4	148,569,103 (GRCm39)	missense	probably benign	0.23
R9600:Mtor	UTSW	4	148,632,092 (GRCm39)	missense	possibly damaging	0.82
R9622:Mtor	UTSW	4	148,568,169 (GRCm39)	missense	probably damaging	0.99
X0025:Mtor	UTSW	4	148,615,171 (GRCm39)	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	possibly damaging	0.69
Z1176:Mtor	UTSW	4	148,634,582 (GRCm39)	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGTAGCCCCAAAGCAGCATG -3'
(R):5'- AAGGGACAAGTGCTCACTGC -3'

Sequencing Primer
(F):5'- TGCAGCAATGCAGAAAACACTG -3'
(R):5'- AAGTGCTCACTGCCTGGC -3'

Posted On

2015-05-15