Incidental Mutation 'R4073:Srp72'
ID316388
Institutional Source Beutler Lab
Gene Symbol Srp72
Ensembl Gene ENSMUSG00000036323
Gene Namesignal recognition particle 72
Synonyms72kDa, 5730576P14Rik
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R4073 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76974683-76999937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76998251 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 633 (T633K)
Ref Sequence ENSEMBL: ENSMUSP00000098648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101087] [ENSMUST00000120550]
Predicted Effect probably benign
Transcript: ENSMUST00000101087
AA Change: T633K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098648
Gene: ENSMUSG00000036323
AA Change: T633K

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 70 2.7e-2 PFAM
Pfam:SRP_TPR_like 30 157 5.5e-25 PFAM
Pfam:TPR_8 176 208 2.3e-3 PFAM
Pfam:TPR_1 226 259 2.4e-4 PFAM
Pfam:TPR_2 226 259 4.9e-5 PFAM
Pfam:TPR_8 226 259 1.1e-2 PFAM
Pfam:TPR_9 412 490 1.3e-3 PFAM
Pfam:SRP72 531 588 6.2e-26 PFAM
low complexity region 630 639 N/A INTRINSIC
low complexity region 647 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120550
AA Change: T572K

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113312
Gene: ENSMUSG00000036323
AA Change: T572K

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 72 2.5e-2 PFAM
Blast:TPR 109 142 2e-11 BLAST
Blast:TPR 176 209 5e-10 BLAST
Pfam:TPR_6 280 310 2.5e-3 PFAM
Pfam:TPR_9 351 429 1.4e-3 PFAM
Pfam:SRP72 465 527 5.8e-24 PFAM
low complexity region 569 578 N/A INTRINSIC
low complexity region 586 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146167
Meta Mutation Damage Score 0.1820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Cbs C T 17: 31,633,005 C8Y possibly damaging Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nrm T A 17: 35,861,532 probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc28a3 T C 13: 58,559,290 I565V probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Spink12 A G 18: 44,104,664 N3S possibly damaging Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Srp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Srp72 APN 5 76984176 missense probably damaging 1.00
IGL00915:Srp72 APN 5 76978613 nonsense probably null
IGL02731:Srp72 APN 5 76994215 missense probably damaging 0.98
PIT4468001:Srp72 UTSW 5 76994206 missense probably benign
R0009:Srp72 UTSW 5 76987885 missense probably damaging 0.98
R0318:Srp72 UTSW 5 76984200 missense probably benign 0.27
R1645:Srp72 UTSW 5 76998278 missense probably benign 0.05
R1678:Srp72 UTSW 5 76980307 missense probably damaging 1.00
R1682:Srp72 UTSW 5 76987870 missense possibly damaging 0.95
R2037:Srp72 UTSW 5 76976491 missense probably damaging 1.00
R2364:Srp72 UTSW 5 76984362 missense probably benign 0.00
R2876:Srp72 UTSW 5 76995920 splice site probably benign
R4072:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4074:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4638:Srp72 UTSW 5 76990295 missense probably benign 0.00
R4803:Srp72 UTSW 5 76984384 missense probably damaging 0.97
R4864:Srp72 UTSW 5 76984162 missense probably benign 0.35
R5188:Srp72 UTSW 5 76974751 missense possibly damaging 0.54
R5217:Srp72 UTSW 5 76980528 missense probably damaging 1.00
R5459:Srp72 UTSW 5 76984338 missense probably benign 0.16
R5616:Srp72 UTSW 5 76987934 missense probably damaging 1.00
R6460:Srp72 UTSW 5 76987991 missense probably damaging 1.00
R6595:Srp72 UTSW 5 76984200 missense probably benign 0.27
R6959:Srp72 UTSW 5 76994223 missense possibly damaging 0.91
R6986:Srp72 UTSW 5 76994876 missense probably benign 0.16
R7674:Srp72 UTSW 5 76974826 missense probably damaging 0.98
Z1177:Srp72 UTSW 5 76998353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGTGGGAAATTATTAGGTATGG -3'
(R):5'- CATTTCAGGACTATGGGGATGG -3'

Sequencing Primer
(F):5'- TGGAAAGTTAAATCCACGCACATACG -3'
(R):5'- AGGAGGGAGCTCTGTGC -3'
Posted On2015-05-15