Incidental Mutation 'R0390:Ubr5'
ID 31639
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Name ubiquitin protein ligase E3 component n-recognin 5
Synonyms Edd, 4432411E13Rik, Edd1
MMRRC Submission 038596-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0390 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 37967328-38078854 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38030672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 426 (L426I)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110336
AA Change: L420I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: L420I

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: L426I

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 (GRCm38) V136E probably damaging Het
Adam18 C T 8: 24,674,054 (GRCm38) G38R probably benign Het
Ap2m1 T C 16: 20,541,099 (GRCm38) M183T probably damaging Het
Apob A T 12: 7,988,678 (GRCm38) I364F probably damaging Het
Arl6 A T 16: 59,622,421 (GRCm38) probably benign Het
Cand2 A G 6: 115,774,653 (GRCm38) M15V possibly damaging Het
Cbl A G 9: 44,201,005 (GRCm38) F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 (GRCm38) H442L probably benign Het
Ccdc74a A G 16: 17,650,476 (GRCm38) S321G probably benign Het
Cdc14b T C 13: 64,210,192 (GRCm38) probably benign Het
Cep152 T C 2: 125,576,869 (GRCm38) probably benign Het
Cep290 A G 10: 100,508,758 (GRCm38) E479G probably benign Het
Chrm2 T G 6: 36,524,111 (GRCm38) I301R probably benign Het
Clec2e A G 6: 129,093,468 (GRCm38) W197R probably damaging Het
Cnot10 G T 9: 114,629,150 (GRCm38) S96* probably null Het
Col19a1 A G 1: 24,289,655 (GRCm38) probably benign Het
Csmd2 T C 4: 128,133,673 (GRCm38) probably benign Het
Cthrc1 A T 15: 39,086,764 (GRCm38) *172L probably null Het
Cul9 A T 17: 46,528,589 (GRCm38) I821N probably benign Het
Daam1 G C 12: 71,975,304 (GRCm38) probably benign Het
Dhx58 A T 11: 100,699,264 (GRCm38) I398N probably damaging Het
Dip2b T A 15: 100,193,913 (GRCm38) H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 (GRCm38) D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 (GRCm38) Q1529K probably benign Het
Dtna C T 18: 23,597,501 (GRCm38) P315L probably damaging Het
Ep300 T C 15: 81,640,116 (GRCm38) S1382P unknown Het
Fat2 A T 11: 55,310,777 (GRCm38) N490K probably damaging Het
Flg2 T A 3: 93,200,355 (GRCm38) probably benign Het
Gm13084 T A 4: 143,811,699 (GRCm38) D234V probably benign Het
Gpatch1 T C 7: 35,281,381 (GRCm38) probably benign Het
Grin2a C A 16: 9,579,585 (GRCm38) K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 (GRCm38) I164S possibly damaging Het
Hinfp A C 9: 44,298,948 (GRCm38) C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 (GRCm38) probably benign Het
Hsd3b1 A T 3: 98,853,039 (GRCm38) L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 (GRCm38) probably null Het
Igf2bp2 A G 16: 22,081,801 (GRCm38) F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 (GRCm38) I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 (GRCm38) I204T probably damaging Het
Kpna6 A T 4: 129,657,804 (GRCm38) S65R possibly damaging Het
Lama3 A T 18: 12,407,563 (GRCm38) D308V probably benign Het
Larp4b T A 13: 9,158,107 (GRCm38) probably null Het
Lgr6 C T 1: 134,994,010 (GRCm38) A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 (GRCm38) T11S probably benign Het
Man1c1 A G 4: 134,578,315 (GRCm38) L366P probably damaging Het
Mef2a A G 7: 67,251,724 (GRCm38) M100T probably damaging Het
Mettl13 G A 1: 162,538,889 (GRCm38) H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 (GRCm38) D352G probably benign Het
Mns1 T C 9: 72,452,804 (GRCm38) I412T probably damaging Het
Mon2 T C 10: 123,007,021 (GRCm38) D1501G probably null Het
Mylk G T 16: 34,875,620 (GRCm38) G242W probably damaging Het
Nav1 T C 1: 135,449,966 (GRCm38) D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 (GRCm38) S2P probably damaging Het
Nek3 A T 8: 22,128,729 (GRCm38) probably benign Het
Nfrkb A G 9: 31,388,897 (GRCm38) probably benign Het
Nlrp4d T C 7: 10,388,778 (GRCm38) D53G probably benign Het
Nol8 T C 13: 49,662,152 (GRCm38) S561P probably damaging Het
Nuf2 A C 1: 169,525,297 (GRCm38) probably benign Het
Ofcc1 T A 13: 40,015,313 (GRCm38) D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 (GRCm38) I150V probably benign Het
Optn A G 2: 5,046,195 (GRCm38) L125P probably benign Het
Otoa T A 7: 121,131,341 (GRCm38) F588Y probably benign Het
Pappa T A 4: 65,351,613 (GRCm38) probably null Het
Pde5a T G 3: 122,835,583 (GRCm38) C635W probably damaging Het
Pdgfb A T 15: 80,003,419 (GRCm38) probably null Het
Pih1d2 T A 9: 50,621,046 (GRCm38) C135S probably damaging Het
Plcg1 G T 2: 160,752,366 (GRCm38) C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 (GRCm38) probably benign Het
Prdm10 G A 9: 31,349,268 (GRCm38) probably null Het
Prex2 T A 1: 11,089,706 (GRCm38) probably null Het
Prss56 T G 1: 87,184,730 (GRCm38) probably null Het
Prtg A G 9: 72,844,958 (GRCm38) K209E probably benign Het
Ptprc G A 1: 138,122,575 (GRCm38) T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 (GRCm38) Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 (GRCm38) M759K probably damaging Het
Rbm15b T A 9: 106,885,998 (GRCm38) M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 (GRCm38) V500A probably damaging Het
Rgs6 A G 12: 83,133,677 (GRCm38) K434R probably damaging Het
Rims1 C T 1: 22,596,526 (GRCm38) A125T possibly damaging Het
Robo3 A G 9: 37,422,177 (GRCm38) V746A probably benign Het
Rtl1 C T 12: 109,591,386 (GRCm38) E1340K unknown Het
Sacs G A 14: 61,205,640 (GRCm38) D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 (GRCm38) P19S probably benign Het
Samhd1 T C 2: 157,114,231 (GRCm38) Y347C probably damaging Het
Sema6d T A 2: 124,658,490 (GRCm38) I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 (GRCm38) A4T probably benign Het
Skint9 C A 4: 112,389,179 (GRCm38) L245F probably benign Het
Slc35f5 T C 1: 125,585,095 (GRCm38) L372P probably damaging Het
Smc1b A T 15: 85,066,277 (GRCm38) I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 (GRCm38) probably benign Het
Sptlc1 T C 13: 53,337,612 (GRCm38) D417G probably benign Het
Sv2c T C 13: 96,088,708 (GRCm38) N31S probably benign Het
Tjp1 T C 7: 65,314,990 (GRCm38) D811G probably damaging Het
Top2b A G 14: 16,418,442 (GRCm38) T1221A probably benign Het
Tph2 T C 10: 115,174,109 (GRCm38) D182G probably damaging Het
Traf6 C T 2: 101,688,588 (GRCm38) Q141* probably null Het
Ttn T C 2: 76,756,931 (GRCm38) D21574G probably damaging Het
Uba2 T A 7: 34,151,021 (GRCm38) N367I probably benign Het
Ube2b T C 11: 51,988,602 (GRCm38) probably benign Het
Ugt2a2 T A 5: 87,464,148 (GRCm38) H301L probably benign Het
Upf2 T A 2: 6,018,894 (GRCm38) probably benign Het
Utrn T C 10: 12,710,060 (GRCm38) D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 (GRCm38) D734G probably damaging Het
Vmn2r68 C G 7: 85,233,258 (GRCm38) probably null Het
Vmn2r68 T A 7: 85,233,249 (GRCm38) probably benign Het
Vwf T A 6: 125,626,361 (GRCm38) Y891* probably null Het
Wwox C T 8: 114,706,278 (GRCm38) T228I probably benign Het
Zer1 C T 2: 30,108,213 (GRCm38) probably benign Het
Zfp180 C T 7: 24,104,707 (GRCm38) H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 (GRCm38) Y279N probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37,984,036 (GRCm38) missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38,004,321 (GRCm38) missense probably benign 0.11
IGL00675:Ubr5 APN 15 38,018,284 (GRCm38) missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38,006,541 (GRCm38) missense probably benign 0.27
IGL00774:Ubr5 APN 15 38,006,541 (GRCm38) missense probably benign 0.27
IGL00919:Ubr5 APN 15 38,040,842 (GRCm38) missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37,985,934 (GRCm38) missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37,981,523 (GRCm38) missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37,973,006 (GRCm38) missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38,009,631 (GRCm38) missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37,998,379 (GRCm38) missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37,996,598 (GRCm38) missense probably benign 0.08
IGL01993:Ubr5 APN 15 37,973,012 (GRCm38) missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37,991,379 (GRCm38) splice site probably benign
IGL02252:Ubr5 APN 15 38,024,894 (GRCm38) missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38,037,901 (GRCm38) missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38,030,689 (GRCm38) missense probably benign 0.01
IGL02503:Ubr5 APN 15 38,018,314 (GRCm38) missense probably damaging 0.99
IGL02503:Ubr5 APN 15 38,018,320 (GRCm38) missense possibly damaging 0.90
IGL02546:Ubr5 APN 15 38,008,747 (GRCm38) missense probably benign 0.00
IGL02556:Ubr5 APN 15 38,002,448 (GRCm38) missense probably benign 0.18
IGL02647:Ubr5 APN 15 37,992,082 (GRCm38) missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38,002,314 (GRCm38) missense probably benign 0.36
IGL02726:Ubr5 APN 15 38,000,562 (GRCm38) splice site probably benign
IGL02884:Ubr5 APN 15 37,998,376 (GRCm38) missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38,041,952 (GRCm38) missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38,024,852 (GRCm38) missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38,047,593 (GRCm38) missense probably benign 0.00
IGL03057:Ubr5 APN 15 38,040,906 (GRCm38) splice site probably benign
IGL03085:Ubr5 APN 15 38,029,568 (GRCm38) missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38,045,720 (GRCm38) missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37,998,316 (GRCm38) missense probably damaging 0.96
Anchovy UTSW 15 37,979,832 (GRCm38) missense probably null
P0016:Ubr5 UTSW 15 38,000,578 (GRCm38) missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38,041,909 (GRCm38) missense
R0133:Ubr5 UTSW 15 37,996,571 (GRCm38) missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38,004,675 (GRCm38) missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37,968,493 (GRCm38) missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37,968,493 (GRCm38) missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37,997,187 (GRCm38) missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38,018,957 (GRCm38) missense probably benign 0.00
R0415:Ubr5 UTSW 15 37,972,980 (GRCm38) missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37,991,344 (GRCm38) missense probably benign 0.34
R0650:Ubr5 UTSW 15 38,030,807 (GRCm38) splice site probably benign
R0720:Ubr5 UTSW 15 37,972,991 (GRCm38) missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37,997,175 (GRCm38) missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38,041,479 (GRCm38) missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38,014,924 (GRCm38) splice site probably benign
R1507:Ubr5 UTSW 15 37,980,870 (GRCm38) missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38,040,841 (GRCm38) missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38,030,730 (GRCm38) missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38,009,113 (GRCm38) unclassified probably benign
R1721:Ubr5 UTSW 15 38,041,846 (GRCm38) missense probably benign 0.18
R1799:Ubr5 UTSW 15 37,989,377 (GRCm38) missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37,980,917 (GRCm38) missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38,041,846 (GRCm38) missense probably benign 0.18
R1868:Ubr5 UTSW 15 38,041,846 (GRCm38) missense probably benign 0.18
R2065:Ubr5 UTSW 15 38,040,842 (GRCm38) missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37,989,302 (GRCm38) missense probably benign 0.00
R2201:Ubr5 UTSW 15 38,002,299 (GRCm38) missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37,988,284 (GRCm38) missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37,989,345 (GRCm38) missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38,002,319 (GRCm38) missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38,030,845 (GRCm38) missense probably benign
R3412:Ubr5 UTSW 15 38,004,235 (GRCm38) splice site probably benign
R3898:Ubr5 UTSW 15 37,997,739 (GRCm38) missense probably benign 0.02
R3900:Ubr5 UTSW 15 38,019,242 (GRCm38) missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38,024,837 (GRCm38) missense
R4352:Ubr5 UTSW 15 38,041,573 (GRCm38) missense probably benign 0.31
R4362:Ubr5 UTSW 15 38,078,403 (GRCm38) missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38,004,336 (GRCm38) missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38,013,542 (GRCm38) missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38,037,967 (GRCm38) missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38,018,297 (GRCm38) missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38,006,564 (GRCm38) missense probably benign 0.01
R4999:Ubr5 UTSW 15 38,009,668 (GRCm38) missense probably benign 0.06
R5057:Ubr5 UTSW 15 38,004,109 (GRCm38) missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38,006,517 (GRCm38) missense probably benign 0.22
R5186:Ubr5 UTSW 15 37,997,916 (GRCm38) missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37,989,578 (GRCm38) missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38,008,739 (GRCm38) missense probably benign 0.00
R5494:Ubr5 UTSW 15 38,019,281 (GRCm38) missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38,030,657 (GRCm38) missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37,983,996 (GRCm38) missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38,015,093 (GRCm38) missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38,002,233 (GRCm38) missense probably benign 0.06
R5781:Ubr5 UTSW 15 38,006,541 (GRCm38) missense probably benign 0.27
R6645:Ubr5 UTSW 15 38,029,506 (GRCm38) missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38,015,135 (GRCm38) missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37,989,598 (GRCm38) missense probably benign 0.08
R6877:Ubr5 UTSW 15 38,002,570 (GRCm38) missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38,008,775 (GRCm38) missense
R7166:Ubr5 UTSW 15 37,976,145 (GRCm38) missense
R7514:Ubr5 UTSW 15 37,988,237 (GRCm38) missense
R7523:Ubr5 UTSW 15 38,004,055 (GRCm38) missense
R7631:Ubr5 UTSW 15 38,029,507 (GRCm38) missense
R7709:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7710:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7712:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7803:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7816:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7817:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7821:Ubr5 UTSW 15 37,997,187 (GRCm38) missense probably damaging 0.96
R7824:Ubr5 UTSW 15 37,991,322 (GRCm38) missense probably damaging 0.97
R7841:Ubr5 UTSW 15 37,980,906 (GRCm38) missense
R7869:Ubr5 UTSW 15 37,979,832 (GRCm38) missense probably null
R7896:Ubr5 UTSW 15 38,041,573 (GRCm38) missense probably benign 0.31
R8191:Ubr5 UTSW 15 38,006,507 (GRCm38) missense
R8342:Ubr5 UTSW 15 38,024,837 (GRCm38) missense
R8745:Ubr5 UTSW 15 38,024,795 (GRCm38) missense
R8811:Ubr5 UTSW 15 38,040,879 (GRCm38) missense
R8904:Ubr5 UTSW 15 38,041,909 (GRCm38) missense
R8955:Ubr5 UTSW 15 38,029,581 (GRCm38) missense
R8956:Ubr5 UTSW 15 38,015,123 (GRCm38) missense probably damaging 1.00
R9051:Ubr5 UTSW 15 38,002,259 (GRCm38) missense
R9102:Ubr5 UTSW 15 38,018,352 (GRCm38) missense
R9183:Ubr5 UTSW 15 37,997,176 (GRCm38) missense
R9235:Ubr5 UTSW 15 38,045,738 (GRCm38) missense
R9392:Ubr5 UTSW 15 37,984,007 (GRCm38) missense
R9473:Ubr5 UTSW 15 38,002,373 (GRCm38) missense
R9596:Ubr5 UTSW 15 37,985,969 (GRCm38) missense
R9659:Ubr5 UTSW 15 37,984,010 (GRCm38) missense
R9683:Ubr5 UTSW 15 37,978,027 (GRCm38) missense
RF024:Ubr5 UTSW 15 38,028,652 (GRCm38) missense
X0024:Ubr5 UTSW 15 37,992,060 (GRCm38) missense probably damaging 1.00
Z1177:Ubr5 UTSW 15 38,040,755 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- GGCTACAGCCATACCATGAACATGC -3'
(R):5'- CTGAGCCTTACAGAAATGCCCAGG -3'

Sequencing Primer
(F):5'- ctctcacctccacacatcc -3'
(R):5'- CCTTACAGAAATGCCCAGGTATATTG -3'
Posted On 2013-04-24