Incidental Mutation 'R4073:Cbs'
ID316421
Institutional Source Beutler Lab
Gene Symbol Cbs
Ensembl Gene ENSMUSG00000024039
Gene Namecystathionine beta-synthase
SynonymsHIP4
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R4073 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31612623-31637199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31633005 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 8 (C8Y)
Ref Sequence ENSEMBL: ENSMUSP00000117454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067801] [ENSMUST00000078509] [ENSMUST00000118504] [ENSMUST00000135425] [ENSMUST00000151718] [ENSMUST00000155814]
Predicted Effect probably benign
Transcript: ENSMUST00000067801
AA Change: C8Y

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066878
Gene: ENSMUSG00000024039
AA Change: C8Y

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.7e-66 PFAM
CBS 417 465 5.9e-11 SMART
Blast:CBS 482 553 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000078509
AA Change: C8Y

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077597
Gene: ENSMUSG00000024039
AA Change: C8Y

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118504
AA Change: C8Y

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113209
Gene: ENSMUSG00000024039
AA Change: C8Y

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135425
AA Change: C8Y

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118785
Gene: ENSMUSG00000024039
AA Change: C8Y

DomainStartEndE-ValueType
Pfam:PALP 77 175 4.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151718
AA Change: C8Y

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117454
Gene: ENSMUSG00000024039
AA Change: C8Y

DomainStartEndE-ValueType
PDB:4COO|B 1 86 2e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155814
AA Change: C8Y

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118472
Gene: ENSMUSG00000024039
AA Change: C8Y

DomainStartEndE-ValueType
Pfam:PALP 77 193 2.3e-32 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Homozygous targeted mutants are severely growth retarded and die within 5 weeks of birth with enlarged multinucleate hepatocytes filled with lipid and massively elevated plasma homocysteine levels. Heterozygotes have twice normal homocysteine levels, butsurvive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nrm T A 17: 35,861,532 probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc28a3 T C 13: 58,559,290 I565V probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Spink12 A G 18: 44,104,664 N3S possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Cbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Cbs APN 17 31621514 missense possibly damaging 0.90
IGL02030:Cbs APN 17 31625489 critical splice donor site probably null
IGL02089:Cbs APN 17 31615545 missense probably benign 0.13
IGL02274:Cbs APN 17 31625948 unclassified probably null
IGL02733:Cbs APN 17 31625031 missense probably benign 0.01
PIT4418001:Cbs UTSW 17 31615521 missense possibly damaging 0.89
R0334:Cbs UTSW 17 31619156 missense probably damaging 1.00
R0398:Cbs UTSW 17 31617242 missense probably benign 0.01
R0466:Cbs UTSW 17 31616152 missense probably benign
R0732:Cbs UTSW 17 31625029 missense probably benign 0.00
R1125:Cbs UTSW 17 31632831 missense probably benign 0.00
R1586:Cbs UTSW 17 31622474 missense probably damaging 1.00
R1646:Cbs UTSW 17 31613195 missense probably benign 0.00
R1728:Cbs UTSW 17 31620949 missense probably benign 0.35
R1729:Cbs UTSW 17 31620949 missense probably benign 0.35
R1784:Cbs UTSW 17 31620949 missense probably benign 0.35
R1823:Cbs UTSW 17 31624271 missense probably damaging 1.00
R2200:Cbs UTSW 17 31624264 missense probably damaging 1.00
R3829:Cbs UTSW 17 31617381 splice site probably benign
R3892:Cbs UTSW 17 31616074 missense probably benign 0.06
R4089:Cbs UTSW 17 31633006 missense probably benign 0.03
R4799:Cbs UTSW 17 31632852 missense probably damaging 0.99
R5029:Cbs UTSW 17 31615482 missense possibly damaging 0.85
R5194:Cbs UTSW 17 31624224 splice site probably null
R5244:Cbs UTSW 17 31617160 missense probably damaging 1.00
R5660:Cbs UTSW 17 31624246 missense probably damaging 1.00
R5890:Cbs UTSW 17 31613219 missense probably damaging 0.97
R5935:Cbs UTSW 17 31632879 missense probably damaging 0.98
R5936:Cbs UTSW 17 31625094 missense probably damaging 0.98
R6891:Cbs UTSW 17 31622457 missense probably damaging 1.00
R7126:Cbs UTSW 17 31619139 missense probably benign 0.09
R7220:Cbs UTSW 17 31619217 missense probably benign 0.00
R7343:Cbs UTSW 17 31619139 missense possibly damaging 0.74
X0025:Cbs UTSW 17 31616137 missense possibly damaging 0.94
X0057:Cbs UTSW 17 31632970 missense probably benign 0.01
X0067:Cbs UTSW 17 31627555 missense probably damaging 1.00
Z1177:Cbs UTSW 17 31625882 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGCACTGTGTGATAATGTGG -3'
(R):5'- GGATTCAATTGCTGCGTCAG -3'

Sequencing Primer
(F):5'- ATAATGTGGGGAGTCCGCC -3'
(R):5'- CAATTGCTGCGTCAGATGGTAG -3'
Posted On2015-05-15