Incidental Mutation 'R4073:Nrm'
ID316422
Institutional Source Beutler Lab
Gene Symbol Nrm
Ensembl Gene ENSMUSG00000059791
Gene Namenurim (nuclear envelope membrane protein)
Synonyms2610307M02Rik
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R4073 (G1)
Quality Score205
Status Validated
Chromosome17
Chromosomal Location35861318-35865402 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 35861532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074259] [ENSMUST00000082337] [ENSMUST00000122899] [ENSMUST00000127442] [ENSMUST00000144382] [ENSMUST00000174873]
Predicted Effect probably benign
Transcript: ENSMUST00000074259
SMART Domains Protein: ENSMUSP00000073873
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
low complexity region 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082337
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122899
SMART Domains Protein: ENSMUSP00000120343
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127442
SMART Domains Protein: ENSMUSP00000115753
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 27 117 1.5e-39 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 540 6.9e-34 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144382
SMART Domains Protein: ENSMUSP00000116100
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145804
Predicted Effect probably benign
Transcript: ENSMUST00000172931
SMART Domains Protein: ENSMUSP00000134569
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174873
SMART Domains Protein: ENSMUSP00000133355
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Cbs C T 17: 31,633,005 C8Y possibly damaging Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc28a3 T C 13: 58,559,290 I565V probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Spink12 A G 18: 44,104,664 N3S possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Nrm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Nrm APN 17 35864755 missense probably benign 0.06
IGL02511:Nrm APN 17 35861424 missense probably damaging 1.00
R0211:Nrm UTSW 17 35864611 missense probably damaging 1.00
R0557:Nrm UTSW 17 35864632 missense probably damaging 1.00
R0602:Nrm UTSW 17 35864264 nonsense probably null
R0635:Nrm UTSW 17 35864264 nonsense probably null
R1571:Nrm UTSW 17 35864187 missense probably damaging 1.00
R2046:Nrm UTSW 17 35864217 missense probably benign 0.00
R4612:Nrm UTSW 17 35863529 missense probably benign 0.00
R4828:Nrm UTSW 17 35864190 missense possibly damaging 0.72
R6038:Nrm UTSW 17 35861505 missense possibly damaging 0.83
R6322:Nrm UTSW 17 35864713 missense possibly damaging 0.73
R6456:Nrm UTSW 17 35865400 splice site probably null
R7345:Nrm UTSW 17 35864584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGATTCGACCCACAAGG -3'
(R):5'- CTGTCAGTCTTCACTCGCAG -3'

Sequencing Primer
(F):5'- ACGCCTGGGATTCCAACTC -3'
(R):5'- CAGCTTTCTGCACAAGACTAATC -3'
Posted On2015-05-15