Incidental Mutation 'R4073:Spink12'
ID316424
Institutional Source Beutler Lab
Gene Symbol Spink12
Ensembl Gene ENSMUSG00000061144
Gene Nameserine peptidase inhibitor, Kazal type 12
Synonyms9230117E20Rik
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4073 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44104407-44108543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44104664 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3 (N3S)
Ref Sequence ENSEMBL: ENSMUSP00000080025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081271
AA Change: N3S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080025
Gene: ENSMUSG00000061144
AA Change: N3S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
KAZAL 49 105 4.52e-12 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Cbs C T 17: 31,633,005 C8Y possibly damaging Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nrm T A 17: 35,861,532 probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc28a3 T C 13: 58,559,290 I565V probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Spink12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Spink12 APN 18 44107805 missense probably damaging 1.00
IGL00731:Spink12 APN 18 44108110 utr 3 prime probably benign
IGL01694:Spink12 APN 18 44107760 missense probably damaging 1.00
IGL02379:Spink12 APN 18 44106508 splice site probably benign
IGL02702:Spink12 APN 18 44104769 missense probably benign 0.00
R0001:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0002:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0043:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0043:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0565:Spink12 UTSW 18 44104688 nonsense probably null
R0639:Spink12 UTSW 18 44107764 nonsense probably null
R1636:Spink12 UTSW 18 44107728 missense probably benign 0.10
R5398:Spink12 UTSW 18 44107727 missense possibly damaging 0.46
R7620:Spink12 UTSW 18 44104617 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGACTGGAAAGGGCCTG -3'
(R):5'- GTGTTGGGGCATCACTCATC -3'

Sequencing Primer
(F):5'- AAAGGGCCTGAAATGAGTTTCTTTG -3'
(R):5'- GGGGCATCACTCATCATTGTTC -3'
Posted On2015-05-15