Incidental Mutation 'R4073:Olfr1469'
ID316425
Institutional Source Beutler Lab
Gene Symbol Olfr1469
Ensembl Gene ENSMUSG00000063777
Gene Nameolfactory receptor 1469
SynonymsGA_x6K02T2RE5P-3743369-3744289, MOR202-11
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4073 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13407849-13414540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13410935 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000150006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077538] [ENSMUST00000216910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077538
AA Change: R122H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076741
Gene: ENSMUSG00000063777
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-47 PFAM
Pfam:7tm_1 42 290 2.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216910
AA Change: R122H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.2696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Cbs C T 17: 31,633,005 C8Y possibly damaging Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nrm T A 17: 35,861,532 probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc28a3 T C 13: 58,559,290 I565V probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Spink12 A G 18: 44,104,664 N3S possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Olfr1469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1469 APN 19 13411226 missense probably benign 0.01
IGL01520:Olfr1469 APN 19 13410750 missense probably damaging 0.97
IGL01671:Olfr1469 APN 19 13410891 missense probably benign 0.29
IGL02247:Olfr1469 APN 19 13411467 missense probably benign 0.01
IGL02297:Olfr1469 APN 19 13411475 missense probably benign 0.00
IGL02417:Olfr1469 APN 19 13410895 missense possibly damaging 0.52
IGL02442:Olfr1469 APN 19 13410987 missense probably benign 0.00
IGL02989:Olfr1469 APN 19 13411486 missense probably benign
IGL03269:Olfr1469 APN 19 13411428 missense probably damaging 0.99
IGL02988:Olfr1469 UTSW 19 13411462 missense possibly damaging 0.75
R0707:Olfr1469 UTSW 19 13411420 missense probably benign 0.22
R1055:Olfr1469 UTSW 19 13411390 missense probably benign 0.10
R1102:Olfr1469 UTSW 19 13411090 missense probably damaging 1.00
R1946:Olfr1469 UTSW 19 13410779 missense possibly damaging 0.64
R2111:Olfr1469 UTSW 19 13410943 missense probably damaging 0.99
R4072:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4076:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4726:Olfr1469 UTSW 19 13411105 missense probably damaging 1.00
R4939:Olfr1469 UTSW 19 13410855 missense probably benign 0.10
R5914:Olfr1469 UTSW 19 13410962 missense probably benign 0.31
R6003:Olfr1469 UTSW 19 13411039 missense probably benign 0.34
R6743:Olfr1469 UTSW 19 13410593 missense probably damaging 1.00
R6825:Olfr1469 UTSW 19 13411150 missense probably benign 0.01
R6826:Olfr1469 UTSW 19 13411088 missense probably benign 0.05
R6970:Olfr1469 UTSW 19 13411428 missense probably damaging 0.99
R7558:Olfr1469 UTSW 19 13410991 missense probably damaging 1.00
R7596:Olfr1469 UTSW 19 13411147 missense probably benign 0.01
R7923:Olfr1469 UTSW 19 13410818 missense probably benign 0.17
R8014:Olfr1469 UTSW 19 13410811 missense not run
R8506:Olfr1469 UTSW 19 13411240 missense possibly damaging 0.49
R8746:Olfr1469 UTSW 19 13410728 missense probably benign 0.44
R8803:Olfr1469 UTSW 19 13410673 missense probably damaging 0.99
Z1177:Olfr1469 UTSW 19 13410719 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGCTGATTGTCCTGGACTC -3'
(R):5'- CCATGACTGCTGGAATATCACAG -3'

Sequencing Primer
(F):5'- GATTGTCCTGGACTCTCGTC -3'
(R):5'- TCACAGAAGAAGTGATGCACTAC -3'
Posted On2015-05-15