Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Scg2'

316433

Institutional Source

Beutler Lab

Gene Symbol

Scg2

Ensembl Gene

ENSMUSG00000050711

Gene Name

secretogranin II

Synonyms

SgII, Chgc

MMRRC Submission

040855-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79434669-79440120 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 79436857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 50 (F50V)

Ref Sequence

ENSEMBL: ENSMUSP00000139740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]

AlphaFold

Q03517

Predicted Effect

probably benign
Transcript: ENSMUST00000049972
AA Change: F50V

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: F50V

Domain	Start	End	E-Value	Type
Pfam:Granin	27	614	7.2e-235	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000185234
AA Change: F50V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: F50V

Domain	Start	End	E-Value	Type
Pfam:Granin	27	319	1.4e-123	PFAM
Pfam:Granin	316	574	7.1e-91	PFAM

Meta Mutation Damage Score

0.2026

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Lrig3	C	T	10: 126,013,408	T999I	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Nup205	T	A	6: 35,192,040		probably null	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Vmn2r24	A	T	6: 123,787,415	H417L	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Scg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01347:Scg2	APN	1	79436821	missense	probably benign	0.16
IGL02083:Scg2	APN	1	79436224	missense	probably benign	0.00
IGL02316:Scg2	APN	1	79435681	missense	probably damaging	1.00
IGL02338:Scg2	APN	1	79436493	missense	possibly damaging	0.93
R0281:Scg2	UTSW	1	79435512	missense	possibly damaging	0.95
R0384:Scg2	UTSW	1	79435549	missense	probably benign	0.42
R0501:Scg2	UTSW	1	79435603	missense	probably damaging	1.00
R0909:Scg2	UTSW	1	79435782	missense	possibly damaging	0.74
R1773:Scg2	UTSW	1	79435635	missense	probably benign	0.04
R2254:Scg2	UTSW	1	79436500	missense	probably damaging	1.00
R4076:Scg2	UTSW	1	79436857	missense	probably damaging	0.97
R4097:Scg2	UTSW	1	79435821	missense	probably damaging	0.99
R4560:Scg2	UTSW	1	79435181	missense	probably damaging	1.00
R4621:Scg2	UTSW	1	79436664	missense	probably benign	0.08
R4876:Scg2	UTSW	1	79435919	missense	probably damaging	1.00
R4944:Scg2	UTSW	1	79436476	nonsense	probably null
R5829:Scg2	UTSW	1	79436920	missense	probably damaging	1.00
R6158:Scg2	UTSW	1	79435400	missense	probably damaging	1.00
R6248:Scg2	UTSW	1	79436306	missense	probably benign	0.29
R6365:Scg2	UTSW	1	79435300	missense	probably benign
R6459:Scg2	UTSW	1	79436290	missense	probably damaging	1.00
R6676:Scg2	UTSW	1	79435782	missense	possibly damaging	0.74
R6693:Scg2	UTSW	1	79436020	missense	probably benign	0.01
R7259:Scg2	UTSW	1	79436985	missense	probably benign
R7393:Scg2	UTSW	1	79435231	missense	probably damaging	1.00
R7578:Scg2	UTSW	1	79436895	missense	probably damaging	0.99
R7608:Scg2	UTSW	1	79436181	missense	probably benign	0.00
R8166:Scg2	UTSW	1	79435583	missense	possibly damaging	0.56
R8247:Scg2	UTSW	1	79436519	missense	possibly damaging	0.92
R8296:Scg2	UTSW	1	79435505	missense	probably benign	0.13
R8308:Scg2	UTSW	1	79436859	missense	probably benign	0.18
R8789:Scg2	UTSW	1	79435783	missense	probably benign	0.05
R9252:Scg2	UTSW	1	79436352	missense	probably damaging	0.98
R9286:Scg2	UTSW	1	79435936	missense	probably damaging	1.00
R9489:Scg2	UTSW	1	79435219	missense	probably damaging	1.00
R9605:Scg2	UTSW	1	79435219	missense	probably damaging	1.00
Z1176:Scg2	UTSW	1	79436789	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGTATTATCCGCATCCACTCG -3'
(R):5'- CGTGCCTTCAAGCTCGTATC -3'

Sequencing Primer
(F):5'- TCTTCACTCAGTGCATCCCTTGAG -3'
(R):5'- GTGCCTTCAAGCTCGTATCATCTG -3'

Posted On

2015-05-15