Incidental Mutation 'R4074:Myo3b'
ID316438
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 040855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4074 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70289464 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 984 (F984S)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: F984S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: F984S

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: F956S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: F956S

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably null Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Gnb3 T A 6: 124,836,979 E215D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lilra6 A T 7: 3,914,890 F85Y probably benign Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myh7b T C 2: 155,618,758 I277T probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tesk1 A G 4: 43,443,606 I58V possibly damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Tuba8 T A 6: 121,222,797 S147T probably damaging Het
Usp8 A G 2: 126,752,370 D822G probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAGAACTTACCTTGCCATCTCC -3'
(R):5'- ATCAGTCTTCCAGGGCACAG -3'

Sequencing Primer
(F):5'- TTGACAATCTCTAGTGCCTCACAAG -3'
(R):5'- TTCCAGGGCACAGAGGCAG -3'
Posted On2015-05-15