Incidental Mutation 'R0390:Dip2b'
ID 31644
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 038596-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R0390 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100091794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 844 (H844Q)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: H844Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: H844Q

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: H1078Q

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: H1078Q

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: H844Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: H844Q

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229080
Meta Mutation Damage Score 0.3667 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C T 8: 25,164,070 (GRCm39) G38R probably benign Het
Ap2m1 T C 16: 20,359,849 (GRCm39) M183T probably damaging Het
Apob A T 12: 8,038,678 (GRCm39) I364F probably damaging Het
Arl6 A T 16: 59,442,784 (GRCm39) probably benign Het
Cand2 A G 6: 115,751,614 (GRCm39) M15V possibly damaging Het
Cbl A G 9: 44,112,302 (GRCm39) F131S probably damaging Het
Ccdc74a A G 16: 17,468,340 (GRCm39) S321G probably benign Het
Cdc14b T C 13: 64,358,006 (GRCm39) probably benign Het
Cep152 T C 2: 125,418,789 (GRCm39) probably benign Het
Cep290 A G 10: 100,344,620 (GRCm39) E479G probably benign Het
Chrm2 T G 6: 36,501,046 (GRCm39) I301R probably benign Het
Clec2e A G 6: 129,070,431 (GRCm39) W197R probably damaging Het
Cnot10 G T 9: 114,458,218 (GRCm39) S96* probably null Het
Col19a1 A G 1: 24,328,736 (GRCm39) probably benign Het
Csmd2 T C 4: 128,027,466 (GRCm39) probably benign Het
Cthrc1 A T 15: 38,950,159 (GRCm39) *172L probably null Het
Cul9 A T 17: 46,839,515 (GRCm39) I821N probably benign Het
Daam1 G C 12: 72,022,078 (GRCm39) probably benign Het
Dhx58 A T 11: 100,590,090 (GRCm39) I398N probably damaging Het
Dmac2 A G 7: 25,320,454 (GRCm39) D50G probably damaging Het
Dmxl1 C A 18: 50,012,429 (GRCm39) Q1529K probably benign Het
Dtna C T 18: 23,730,558 (GRCm39) P315L probably damaging Het
Ep300 T C 15: 81,524,317 (GRCm39) S1382P unknown Het
Fat2 A T 11: 55,201,603 (GRCm39) N490K probably damaging Het
Flg2 T A 3: 93,107,662 (GRCm39) probably benign Het
Gpatch1 T C 7: 34,980,806 (GRCm39) probably benign Het
Grin2a C A 16: 9,397,449 (GRCm39) K879N possibly damaging Het
Hacd3 A C 9: 64,908,304 (GRCm39) I164S possibly damaging Het
Hinfp A C 9: 44,210,245 (GRCm39) C197G probably damaging Het
Hsd17b12 T C 2: 93,945,335 (GRCm39) probably benign Het
Hsd3b1 A T 3: 98,760,355 (GRCm39) L212Q probably damaging Het
Ifrd1 C T 12: 40,264,093 (GRCm39) probably null Het
Igf2bp2 A G 16: 21,900,551 (GRCm39) F129L possibly damaging Het
Kirrel3 T A 9: 34,931,459 (GRCm39) I409N probably damaging Het
Klhdc10 T C 6: 30,447,411 (GRCm39) I204T probably damaging Het
Kpna6 A T 4: 129,551,597 (GRCm39) S65R possibly damaging Het
Lama3 A T 18: 12,540,620 (GRCm39) D308V probably benign Het
Larp4b T A 13: 9,208,143 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 (GRCm39) T11S probably benign Het
Man1c1 A G 4: 134,305,626 (GRCm39) L366P probably damaging Het
Mef2a A G 7: 66,901,472 (GRCm39) M100T probably damaging Het
Mettl13 G A 1: 162,366,458 (GRCm39) H474Y possibly damaging Het
Minar2 T A 18: 59,208,760 (GRCm39) V136E probably damaging Het
Mmp3 A G 9: 7,451,320 (GRCm39) D352G probably benign Het
Mns1 T C 9: 72,360,086 (GRCm39) I412T probably damaging Het
Mon2 T C 10: 122,842,926 (GRCm39) D1501G probably null Het
Mylk G T 16: 34,695,990 (GRCm39) G242W probably damaging Het
Nav1 T C 1: 135,377,704 (GRCm39) D1715G possibly damaging Het
Nckap1l T C 15: 103,362,310 (GRCm39) S2P probably damaging Het
Nek3 A T 8: 22,618,745 (GRCm39) probably benign Het
Nfrkb A G 9: 31,300,193 (GRCm39) probably benign Het
Nlrp4d T C 7: 10,122,705 (GRCm39) D53G probably benign Het
Nol8 T C 13: 49,815,628 (GRCm39) S561P probably damaging Het
Nuf2 A C 1: 169,352,866 (GRCm39) probably benign Het
Odad3 T A 9: 21,903,004 (GRCm39) H442L probably benign Het
Ofcc1 T A 13: 40,168,789 (GRCm39) D866V possibly damaging Het
Optn A G 2: 5,051,006 (GRCm39) L125P probably benign Het
Or5k3 A G 16: 58,969,662 (GRCm39) I150V probably benign Het
Otoa T A 7: 120,730,564 (GRCm39) F588Y probably benign Het
Pappa T A 4: 65,269,850 (GRCm39) probably null Het
Pde5a T G 3: 122,629,232 (GRCm39) C635W probably damaging Het
Pdgfb A T 15: 79,887,620 (GRCm39) probably null Het
Pih1d2 T A 9: 50,532,346 (GRCm39) C135S probably damaging Het
Plcg1 G T 2: 160,594,286 (GRCm39) C361F probably damaging Het
Ppp4r4 T C 12: 103,567,619 (GRCm39) probably benign Het
Pramel26 T A 4: 143,538,269 (GRCm39) D234V probably benign Het
Prdm10 G A 9: 31,260,564 (GRCm39) probably null Het
Prex2 T A 1: 11,159,930 (GRCm39) probably null Het
Prss56 T G 1: 87,112,452 (GRCm39) probably null Het
Prtg A G 9: 72,752,240 (GRCm39) K209E probably benign Het
Ptprc G A 1: 138,050,313 (GRCm39) T36I possibly damaging Het
Rasgrp4 A G 7: 28,845,285 (GRCm39) Y302C probably damaging Het
Rb1cc1 T A 1: 6,318,858 (GRCm39) M759K probably damaging Het
Rbm15b T A 9: 106,763,197 (GRCm39) M324L probably benign Het
Rcbtb2 T C 14: 73,415,987 (GRCm39) V500A probably damaging Het
Rgs6 A G 12: 83,180,451 (GRCm39) K434R probably damaging Het
Rims1 C T 1: 22,635,607 (GRCm39) A125T possibly damaging Het
Robo3 A G 9: 37,333,473 (GRCm39) V746A probably benign Het
Rtl1 C T 12: 109,557,820 (GRCm39) E1340K unknown Het
Sacs G A 14: 61,443,089 (GRCm39) D1712N possibly damaging Het
Samd4b G A 7: 28,103,402 (GRCm39) P19S probably benign Het
Samhd1 T C 2: 156,956,151 (GRCm39) Y347C probably damaging Het
Sema6d T A 2: 124,500,410 (GRCm39) I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 (GRCm39) A4T probably benign Het
Skint9 C A 4: 112,246,376 (GRCm39) L245F probably benign Het
Slc35f5 T C 1: 125,512,832 (GRCm39) L372P probably damaging Het
Smc1b A T 15: 84,950,478 (GRCm39) I1182N probably damaging Het
Smyd3 A G 1: 178,785,138 (GRCm39) probably benign Het
Sptlc1 T C 13: 53,491,648 (GRCm39) D417G probably benign Het
Sv2c T C 13: 96,225,216 (GRCm39) N31S probably benign Het
Tjp1 T C 7: 64,964,738 (GRCm39) D811G probably damaging Het
Top2b A G 14: 16,418,442 (GRCm38) T1221A probably benign Het
Tph2 T C 10: 115,010,014 (GRCm39) D182G probably damaging Het
Traf6 C T 2: 101,518,933 (GRCm39) Q141* probably null Het
Ttn T C 2: 76,587,275 (GRCm39) D21574G probably damaging Het
Uba2 T A 7: 33,850,446 (GRCm39) N367I probably benign Het
Ube2b T C 11: 51,879,429 (GRCm39) probably benign Het
Ubr5 G T 15: 38,030,916 (GRCm39) L426I probably benign Het
Ugt2a2 T A 5: 87,612,007 (GRCm39) H301L probably benign Het
Upf2 T A 2: 6,023,705 (GRCm39) probably benign Het
Utrn T C 10: 12,585,804 (GRCm39) D991G probably benign Het
Vmn2r25 T C 6: 123,800,140 (GRCm39) D734G probably damaging Het
Vmn2r68 C G 7: 84,882,466 (GRCm39) probably null Het
Vmn2r68 T A 7: 84,882,457 (GRCm39) probably benign Het
Vwf T A 6: 125,603,324 (GRCm39) Y891* probably null Het
Wwox C T 8: 115,433,018 (GRCm39) T228I probably benign Het
Zer1 C T 2: 29,998,225 (GRCm39) probably benign Het
Zfp180 C T 7: 23,804,132 (GRCm39) H184Y possibly damaging Het
Zfp68 A T 5: 138,605,487 (GRCm39) Y279N probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAGACCTAATATGCAGCCCAC -3'
(R):5'- GACCTGACTGGGAGAACCTGAAATG -3'

Sequencing Primer
(F):5'- AGCCCACATGTCACCTGG -3'
(R):5'- TCTCCTCAAAGACTTGGAGGC -3'
Posted On 2013-04-24