Incidental Mutation 'R4074:Usp8'
ID316441
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
MMRRC Submission 040855-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4074 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126752370 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 822 (D822G)
Ref Sequence ENSEMBL: ENSMUSP00000106046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect probably damaging
Transcript: ENSMUST00000028841
AA Change: D811G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: D811G

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110416
AA Change: D822G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: D822G

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138859
Meta Mutation Damage Score 0.6846 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably null Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Gnb3 T A 6: 124,836,979 E215D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lilra6 A T 7: 3,914,890 F85Y probably benign Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myh7b T C 2: 155,618,758 I277T probably damaging Het
Myo3b T C 2: 70,289,464 F984S probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tesk1 A G 4: 43,443,606 I58V possibly damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Tuba8 T A 6: 121,222,797 S147T probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5625:Usp8 UTSW 2 126742277 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6529:Usp8 UTSW 2 126725378 missense probably benign 0.01
R6551:Usp8 UTSW 2 126733182 intron probably benign
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
R7768:Usp8 UTSW 2 126751123 missense probably damaging 1.00
R8097:Usp8 UTSW 2 126754880 missense probably benign 0.44
R8130:Usp8 UTSW 2 126717998 intron probably benign
Z1177:Usp8 UTSW 2 126758431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTGCAGGTGAGTGATTC -3'
(R):5'- GGCACAGTCCATACTCAGAC -3'

Sequencing Primer
(F):5'- CCTGCAGGTGAGTGATTCCTTTG -3'
(R):5'- CAGTCCATACTCAGACACTAGTG -3'
Posted On2015-05-15