Incidental Mutation 'R4074:Myh7b'
ID316444
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission 040855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4074 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155618758 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 277 (I277T)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: I277T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: I277T

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102357
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably null Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Gnb3 T A 6: 124,836,979 E215D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lilra6 A T 7: 3,914,890 F85Y probably benign Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myo3b T C 2: 70,289,464 F984S probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tesk1 A G 4: 43,443,606 I58V possibly damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Tuba8 T A 6: 121,222,797 S147T probably damaging Het
Usp8 A G 2: 126,752,370 D822G probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
irrational UTSW 2 155630672 unclassified probably benign
muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCCAGTATAGGCCTGCC -3'
(R):5'- AGCATAGGAACATGCGCAC -3'

Sequencing Primer
(F):5'- TGCCTGTGCACAGTCATG -3'
(R):5'- CAAACAGGCTGTGTGTTACC -3'
Posted On2015-05-15