Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Pot1a'

ID

316457

Institutional Source

Beutler Lab

Gene Symbol

Pot1a

Ensembl Gene

ENSMUSG00000029676

Gene Name

protection of telomeres 1A

Synonyms

1500031H18Rik, Pot1

MMRRC Submission

040855-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

6

Chromosomal Location

25743737-25809246 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 25752357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000115330] [ENSMUST00000115330] [ENSMUST00000166445] [ENSMUST00000166445] [ENSMUST00000166445] [ENSMUST00000166445] [ENSMUST00000166445] [ENSMUST00000166445]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115329

SMART Domains

Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

question?

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Lrig3	C	T	10: 126,013,408	T999I	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Nup205	T	A	6: 35,192,040		probably null	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Vmn2r24	A	T	6: 123,787,415	H417L	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Pot1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00857:Pot1a	APN	6	25744628	missense	probably benign	0.01
IGL01393:Pot1a	APN	6	25744631	nonsense	probably null
IGL01411:Pot1a	APN	6	25750144	splice site	probably benign
IGL01774:Pot1a	APN	6	25753277	missense	probably benign	0.00
IGL01981:Pot1a	APN	6	25750100	missense	probably damaging	1.00
IGL02404:Pot1a	APN	6	25764432	splice site	probably benign
IGL02530:Pot1a	APN	6	25794593	missense	probably damaging	1.00
IGL02755:Pot1a	APN	6	25771613	missense	possibly damaging	0.81
IGL03127:Pot1a	APN	6	25794616	missense	probably benign	0.00
IGL03396:Pot1a	APN	6	25745914	missense	possibly damaging	0.93
BB001:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
BB011:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
R0329:Pot1a	UTSW	6	25778831	splice site	probably benign
R0359:Pot1a	UTSW	6	25771680	splice site	probably benign
R0530:Pot1a	UTSW	6	25771541	missense	possibly damaging	0.86
R0840:Pot1a	UTSW	6	25748284	splice site	probably benign
R0918:Pot1a	UTSW	6	25756268	missense	possibly damaging	0.92
R1650:Pot1a	UTSW	6	25745965	missense	probably damaging	1.00
R1937:Pot1a	UTSW	6	25753324	missense	probably benign	0.15
R2142:Pot1a	UTSW	6	25750044	splice site	probably null
R4072:Pot1a	UTSW	6	25752357	splice site	probably null
R4322:Pot1a	UTSW	6	25745930	missense	probably benign	0.02
R4895:Pot1a	UTSW	6	25753206	missense	probably damaging	1.00
R4910:Pot1a	UTSW	6	25746021	intron	probably benign
R4933:Pot1a	UTSW	6	25771541	missense	possibly damaging	0.86
R5530:Pot1a	UTSW	6	25778894	missense	probably damaging	1.00
R5748:Pot1a	UTSW	6	25758856	missense	possibly damaging	0.77
R5775:Pot1a	UTSW	6	25757298	splice site	probably null
R5870:Pot1a	UTSW	6	25778951	missense	possibly damaging	0.90
R6180:Pot1a	UTSW	6	25771621	missense	probably benign	0.00
R6377:Pot1a	UTSW	6	25778870	missense	probably benign	0.06
R7251:Pot1a	UTSW	6	25752498	splice site	probably null
R7457:Pot1a	UTSW	6	25771622	missense	probably benign	0.26
R7679:Pot1a	UTSW	6	25771634	missense	probably benign	0.16
R7717:Pot1a	UTSW	6	25758823	missense	probably benign	0.45
R7924:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
R8078:Pot1a	UTSW	6	25750108	missense	probably benign	0.13
R8084:Pot1a	UTSW	6	25771536	missense	possibly damaging	0.81
R8170:Pot1a	UTSW	6	25758803	makesense	probably null
R9070:Pot1a	UTSW	6	25744630	missense
R9525:Pot1a	UTSW	6	25745917	missense	probably benign	0.06
R9574:Pot1a	UTSW	6	25775719	missense	possibly damaging	0.73
R9638:Pot1a	UTSW	6	25750107	nonsense	probably null
R9698:Pot1a	UTSW	6	25744616	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTACACACCACTTGACTGG -3'
(R):5'- GTGTTACTTATATGTCGCATCTTGC -3'

Sequencing Primer
(F):5'- CACTTGACTGGAAAAGATTACAACTC -3'
(R):5'- GCATCTTGCTCCAATTATATTTGTG -3'

Posted On

2015-05-15