Mutagenetix > Incidental Mutation

Incidental Mutation 'R0390:Grin2a'

31646

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

MMRRC Submission

038596-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

R0390 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 9579585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 879 (K879N)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: K879N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: K879N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: K879N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: K879N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: K879N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: K879N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 92.0%

Validation Efficiency

98% (110/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	T	A	18: 59,075,688	V136E	probably damaging	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ap2m1	T	C	16: 20,541,099	M183T	probably damaging	Het
Apob	A	T	12: 7,988,678	I364F	probably damaging	Het
Arl6	A	T	16: 59,622,421		probably benign	Het
Cand2	A	G	6: 115,774,653	M15V	possibly damaging	Het
Cbl	A	G	9: 44,201,005	F131S	probably damaging	Het
Ccdc151	T	A	9: 21,991,708	H442L	probably benign	Het
Ccdc74a	A	G	16: 17,650,476	S321G	probably benign	Het
Cdc14b	T	C	13: 64,210,192		probably benign	Het
Cep152	T	C	2: 125,576,869		probably benign	Het
Cep290	A	G	10: 100,508,758	E479G	probably benign	Het
Chrm2	T	G	6: 36,524,111	I301R	probably benign	Het
Clec2e	A	G	6: 129,093,468	W197R	probably damaging	Het
Cnot10	G	T	9: 114,629,150	S96*	probably null	Het
Col19a1	A	G	1: 24,289,655		probably benign	Het
Csmd2	T	C	4: 128,133,673		probably benign	Het
Cthrc1	A	T	15: 39,086,764	*172L	probably null	Het
Cul9	A	T	17: 46,528,589	I821N	probably benign	Het
Daam1	G	C	12: 71,975,304		probably benign	Het
Dhx58	A	T	11: 100,699,264	I398N	probably damaging	Het
Dip2b	T	A	15: 100,193,913	H844Q	probably damaging	Het
Dmac2	A	G	7: 25,621,029	D50G	probably damaging	Het
Dmxl1	C	A	18: 49,879,362	Q1529K	probably benign	Het
Dtna	C	T	18: 23,597,501	P315L	probably damaging	Het
Ep300	T	C	15: 81,640,116	S1382P	unknown	Het
Fat2	A	T	11: 55,310,777	N490K	probably damaging	Het
Flg2	T	A	3: 93,200,355		probably benign	Het
Gm13084	T	A	4: 143,811,699	D234V	probably benign	Het
Gpatch1	T	C	7: 35,281,381		probably benign	Het
Hacd3	A	C	9: 65,001,022	I164S	possibly damaging	Het
Hinfp	A	C	9: 44,298,948	C197G	probably damaging	Het
Hsd17b12	T	C	2: 94,114,990		probably benign	Het
Hsd3b1	A	T	3: 98,853,039	L212Q	probably damaging	Het
Ifrd1	C	T	12: 40,214,094		probably null	Het
Igf2bp2	A	G	16: 22,081,801	F129L	possibly damaging	Het
Kirrel3	T	A	9: 35,020,163	I409N	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Kpna6	A	T	4: 129,657,804	S65R	possibly damaging	Het
Lama3	A	T	18: 12,407,563	D308V	probably benign	Het
Larp4b	T	A	13: 9,158,107		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lyzl1	A	T	18: 4,169,175	T11S	probably benign	Het
Man1c1	A	G	4: 134,578,315	L366P	probably damaging	Het
Mef2a	A	G	7: 67,251,724	M100T	probably damaging	Het
Mettl13	G	A	1: 162,538,889	H474Y	possibly damaging	Het
Mmp3	A	G	9: 7,451,320	D352G	probably benign	Het
Mns1	T	C	9: 72,452,804	I412T	probably damaging	Het
Mon2	T	C	10: 123,007,021	D1501G	probably null	Het
Mylk	G	T	16: 34,875,620	G242W	probably damaging	Het
Nav1	T	C	1: 135,449,966	D1715G	possibly damaging	Het
Nckap1l	T	C	15: 103,453,883	S2P	probably damaging	Het
Nek3	A	T	8: 22,128,729		probably benign	Het
Nfrkb	A	G	9: 31,388,897		probably benign	Het
Nlrp4d	T	C	7: 10,388,778	D53G	probably benign	Het
Nol8	T	C	13: 49,662,152	S561P	probably damaging	Het
Nuf2	A	C	1: 169,525,297		probably benign	Het
Ofcc1	T	A	13: 40,015,313	D866V	possibly damaging	Het
Olfr195	A	G	16: 59,149,299	I150V	probably benign	Het
Optn	A	G	2: 5,046,195	L125P	probably benign	Het
Otoa	T	A	7: 121,131,341	F588Y	probably benign	Het
Pappa	T	A	4: 65,351,613		probably null	Het
Pde5a	T	G	3: 122,835,583	C635W	probably damaging	Het
Pdgfb	A	T	15: 80,003,419		probably null	Het
Pih1d2	T	A	9: 50,621,046	C135S	probably damaging	Het
Plcg1	G	T	2: 160,752,366	C361F	probably damaging	Het
Ppp4r4	T	C	12: 103,601,360		probably benign	Het
Prdm10	G	A	9: 31,349,268		probably null	Het
Prex2	T	A	1: 11,089,706		probably null	Het
Prss56	T	G	1: 87,184,730		probably null	Het
Prtg	A	G	9: 72,844,958	K209E	probably benign	Het
Ptprc	G	A	1: 138,122,575	T36I	possibly damaging	Het
Rasgrp4	A	G	7: 29,145,860	Y302C	probably damaging	Het
Rb1cc1	T	A	1: 6,248,634	M759K	probably damaging	Het
Rbm15b	T	A	9: 106,885,998	M324L	probably benign	Het
Rcbtb2	T	C	14: 73,178,547	V500A	probably damaging	Het
Rgs6	A	G	12: 83,133,677	K434R	probably damaging	Het
Rims1	C	T	1: 22,596,526	A125T	possibly damaging	Het
Robo3	A	G	9: 37,422,177	V746A	probably benign	Het
Rtl1	C	T	12: 109,591,386	E1340K	unknown	Het
Sacs	G	A	14: 61,205,640	D1712N	possibly damaging	Het
Samd4b	G	A	7: 28,403,977	P19S	probably benign	Het
Samhd1	T	C	2: 157,114,231	Y347C	probably damaging	Het
Sema6d	T	A	2: 124,658,490	I393N	probably damaging	Het
Sigmar1	C	T	4: 41,741,243	A4T	probably benign	Het
Skint9	C	A	4: 112,389,179	L245F	probably benign	Het
Slc35f5	T	C	1: 125,585,095	L372P	probably damaging	Het
Smc1b	A	T	15: 85,066,277	I1182N	probably damaging	Het
Smyd3	A	G	1: 178,957,573		probably benign	Het
Sptlc1	T	C	13: 53,337,612	D417G	probably benign	Het
Sv2c	T	C	13: 96,088,708	N31S	probably benign	Het
Tjp1	T	C	7: 65,314,990	D811G	probably damaging	Het
Top2b	A	G	14: 16,418,442	T1221A	probably benign	Het
Tph2	T	C	10: 115,174,109	D182G	probably damaging	Het
Traf6	C	T	2: 101,688,588	Q141*	probably null	Het
Ttn	T	C	2: 76,756,931	D21574G	probably damaging	Het
Uba2	T	A	7: 34,151,021	N367I	probably benign	Het
Ube2b	T	C	11: 51,988,602		probably benign	Het
Ubr5	G	T	15: 38,030,672	L426I	probably benign	Het
Ugt2a2	T	A	5: 87,464,148	H301L	probably benign	Het
Upf2	T	A	2: 6,018,894		probably benign	Het
Utrn	T	C	10: 12,710,060	D991G	probably benign	Het
Vmn2r25	T	C	6: 123,823,181	D734G	probably damaging	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vwf	T	A	6: 125,626,361	Y891*	probably null	Het
Wwox	C	T	8: 114,706,278	T228I	probably benign	Het
Zer1	C	T	2: 30,108,213		probably benign	Het
Zfp180	C	T	7: 24,104,707	H184Y	possibly damaging	Het
Zfp68	A	T	5: 138,607,225	Y279N	probably benign	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GAGAGGATGCTGTCCCTGAAACAC -3'
(R):5'- CTTTCTGCTGACATGCGAGCAAC -3'

Sequencing Primer
(F):5'- CCCTTGAAAGGACCTGTTATCTGAG -3'
(R):5'- AGAGTCTCTCAACCCTGATGG -3'

Posted On

2013-04-24