Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Vmn2r24'

316461

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r24

Ensembl Gene

ENSMUSG00000072780

Gene Name

vomeronasal 2, receptor 24

Synonyms

EG243628

MMRRC Submission

040855-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123778971-123816280 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123787415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 417 (H417L)

Ref Sequence

ENSEMBL: ENSMUSP00000074602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075095]

AlphaFold

D3YUI0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075095
AA Change: H417L

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: H417L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	1.6e-32	PFAM
Pfam:NCD3G	518	571	1.1e-22	PFAM
Pfam:7tm_3	602	839	1.1e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Lrig3	C	T	10: 126,013,408	T999I	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Nup205	T	A	6: 35,192,040		probably null	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Vmn2r24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Vmn2r24	APN	6	123815637	missense	probably damaging	1.00
IGL01382:Vmn2r24	APN	6	123786979	missense	possibly damaging	0.62
IGL01592:Vmn2r24	APN	6	123787486	missense	probably benign	0.30
IGL01754:Vmn2r24	APN	6	123804161	missense	probably damaging	1.00
IGL01939:Vmn2r24	APN	6	123787445	missense	probably benign
IGL02140:Vmn2r24	APN	6	123780672	missense	probably damaging	0.98
IGL02272:Vmn2r24	APN	6	123786884	missense	possibly damaging	0.94
IGL02568:Vmn2r24	APN	6	123815853	missense	probably benign	0.36
IGL02748:Vmn2r24	APN	6	123816098	missense	possibly damaging	0.90
IGL03022:Vmn2r24	APN	6	123779008	missense	probably damaging	0.99
IGL03343:Vmn2r24	APN	6	123816111	missense	probably damaging	1.00
R0357:Vmn2r24	UTSW	6	123815410	frame shift	probably null
R0453:Vmn2r24	UTSW	6	123780391	critical splice acceptor site	probably null
R0538:Vmn2r24	UTSW	6	123816053	missense	probably benign	0.32
R0607:Vmn2r24	UTSW	6	123786934	missense	probably benign
R1381:Vmn2r24	UTSW	6	123786733	missense	probably damaging	1.00
R1589:Vmn2r24	UTSW	6	123806520	splice site	probably benign
R1848:Vmn2r24	UTSW	6	123816224	missense	probably damaging	1.00
R2035:Vmn2r24	UTSW	6	123816060	missense	probably damaging	1.00
R2077:Vmn2r24	UTSW	6	123815399	missense	probably damaging	1.00
R2122:Vmn2r24	UTSW	6	123815394	missense	possibly damaging	0.81
R2145:Vmn2r24	UTSW	6	123779013	missense	probably benign
R2483:Vmn2r24	UTSW	6	123816038	missense	probably damaging	1.00
R2512:Vmn2r24	UTSW	6	123787026	missense	probably benign	0.01
R3001:Vmn2r24	UTSW	6	123804272	missense	probably benign	0.00
R3002:Vmn2r24	UTSW	6	123804272	missense	probably benign	0.00
R3236:Vmn2r24	UTSW	6	123779025	nonsense	probably null
R3623:Vmn2r24	UTSW	6	123816038	missense	probably damaging	1.00
R3624:Vmn2r24	UTSW	6	123816038	missense	probably damaging	1.00
R3835:Vmn2r24	UTSW	6	123787453	missense	probably benign	0.33
R4075:Vmn2r24	UTSW	6	123787415	missense	possibly damaging	0.92
R4812:Vmn2r24	UTSW	6	123779185	missense	probably benign	0.00
R4825:Vmn2r24	UTSW	6	123815780	missense	probably benign	0.02
R5351:Vmn2r24	UTSW	6	123816264	missense	possibly damaging	0.80
R5665:Vmn2r24	UTSW	6	123786979	missense	possibly damaging	0.62
R5790:Vmn2r24	UTSW	6	123815540	missense	probably benign
R5808:Vmn2r24	UTSW	6	123815638	nonsense	probably null
R5879:Vmn2r24	UTSW	6	123787267	missense	possibly damaging	0.89
R5923:Vmn2r24	UTSW	6	123815792	missense	probably damaging	0.96
R5969:Vmn2r24	UTSW	6	123779022	missense	probably benign	0.00
R6050:Vmn2r24	UTSW	6	123815732	missense	probably damaging	1.00
R6171:Vmn2r24	UTSW	6	123787246	missense	probably damaging	0.98
R6174:Vmn2r24	UTSW	6	123816277	missense	probably benign	0.00
R6356:Vmn2r24	UTSW	6	123806409	missense	possibly damaging	0.93
R6562:Vmn2r24	UTSW	6	123780427	missense	probably benign	0.01
R6563:Vmn2r24	UTSW	6	123804178	missense	possibly damaging	0.86
R6584:Vmn2r24	UTSW	6	123815805	missense	possibly damaging	0.53
R6630:Vmn2r24	UTSW	6	123787022	missense	probably benign	0.00
R6803:Vmn2r24	UTSW	6	123779001	missense	possibly damaging	0.64
R6864:Vmn2r24	UTSW	6	123779158	missense	possibly damaging	0.89
R7252:Vmn2r24	UTSW	6	123787232	missense	possibly damaging	0.90
R7369:Vmn2r24	UTSW	6	123815679	missense	probably damaging	0.99
R7646:Vmn2r24	UTSW	6	123816210	missense	probably benign	0.20
R7799:Vmn2r24	UTSW	6	123780463	missense	probably benign	0.00
R7803:Vmn2r24	UTSW	6	123780479	missense	probably benign	0.00
R7959:Vmn2r24	UTSW	6	123778990	missense	possibly damaging	0.86
R8215:Vmn2r24	UTSW	6	123779118	missense	probably benign	0.10
R8796:Vmn2r24	UTSW	6	123780541	missense	probably benign
R9172:Vmn2r24	UTSW	6	123806473	missense	probably damaging	1.00
R9300:Vmn2r24	UTSW	6	123816071	missense	possibly damaging	0.46
R9369:Vmn2r24	UTSW	6	123815398	missense	probably damaging	1.00
R9375:Vmn2r24	UTSW	6	123815583	missense	probably damaging	1.00
R9523:Vmn2r24	UTSW	6	123786991	missense	possibly damaging	0.89
R9546:Vmn2r24	UTSW	6	123787307	missense	probably damaging	0.98
RF006:Vmn2r24	UTSW	6	123806419	missense	probably damaging	1.00
RF016:Vmn2r24	UTSW	6	123804215	missense	probably benign	0.04
X0023:Vmn2r24	UTSW	6	123787400	missense	probably damaging	0.99
Z1088:Vmn2r24	UTSW	6	123804196	missense	probably benign	0.00
Z1177:Vmn2r24	UTSW	6	123786760	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTATCCAGGATGTGTGGTCCATC -3'
(R):5'- TACTTTGAGAAGGAGATAGTAGCAC -3'

Sequencing Primer
(F):5'- GTGGTCCATCTTATTTGAATGCC -3'
(R):5'- TGAGAAGGAGATAGTAGCACATATTC -3'

Posted On

2015-05-15