Incidental Mutation 'R4074:Lilra6'
ID316465
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
SynonymsPira3, 7M1
MMRRC Submission 040855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4074 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3908280-3915503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3914890 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 85 (F85Y)
Ref Sequence ENSEMBL: ENSMUSP00000088188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
Predicted Effect probably benign
Transcript: ENSMUST00000038176
AA Change: F85Y

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: F85Y

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090689
AA Change: F85Y

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: F85Y

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131255
Predicted Effect probably benign
Transcript: ENSMUST00000206077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206851
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably null Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Gnb3 T A 6: 124,836,979 E215D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myh7b T C 2: 155,618,758 I277T probably damaging Het
Myo3b T C 2: 70,289,464 F984S probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tesk1 A G 4: 43,443,606 I58V possibly damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Tuba8 T A 6: 121,222,797 S147T probably damaging Het
Usp8 A G 2: 126,752,370 D822G probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3912996 missense probably benign 0.16
R8056:Lilra6 UTSW 7 3912552 missense probably damaging 1.00
R8280:Lilra6 UTSW 7 3913047 missense probably benign 0.01
Z1176:Lilra6 UTSW 7 3915074 critical splice acceptor site probably null
Z1177:Lilra6 UTSW 7 3912581 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTGAGGTTCCCACAGTGAG -3'
(R):5'- GTCCTGAGTCCTAGTTGCTC -3'

Sequencing Primer
(F):5'- CACAGTGAGGGTGGGCATTC -3'
(R):5'- AGTCCTAGTTGCTCTGTTACTTGCAG -3'
Posted On2015-05-15