Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Axl'

316467

Institutional Source

Beutler Lab

Gene Symbol

Axl

Ensembl Gene

ENSMUSG00000002602

Gene Name

AXL receptor tyrosine kinase

Synonyms

Tyro7, Ufo, Ark

MMRRC Submission

040855-MU

Accession Numbers

Genbank: NM_009465; MGI: 1347244

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25757273-25788705 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 25763911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]

AlphaFold

Q00993

Predicted Effect

probably benign
Transcript: ENSMUST00000002677

SMART Domains

Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	444	466	N/A	INTRINSIC
low complexity region	489	501	N/A	INTRINSIC
TyrKc	530	797	1.91e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085948

SMART Domains

Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	435	457	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
TyrKc	521	788	1.91e-134	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124442

Predicted Effect

probably benign
Transcript: ENSMUST00000132038

SMART Domains

Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
Blast:FN3	2	42	8e-20	BLAST
SCOP:d1gh7a2	2	61	4e-7	SMART
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	113	125	N/A	INTRINSIC
Pfam:Pkinase_Tyr	154	188	4.1e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132989

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137211

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Lrig3	C	T	10: 126,013,408	T999I	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Nup205	T	A	6: 35,192,040		probably null	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Vmn2r24	A	T	6: 123,787,415	H417L	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Axl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Axl	APN	7	25785899	missense	probably benign	0.16
IGL00428:Axl	APN	7	25760872	missense	probably damaging	1.00
IGL00725:Axl	APN	7	25764483	missense	probably damaging	0.97
IGL01348:Axl	APN	7	25763309	missense	probably damaging	1.00
IGL01350:Axl	APN	7	25758750	missense	probably damaging	1.00
IGL01357:Axl	APN	7	25774169	missense	probably benign	0.00
IGL02314:Axl	APN	7	25786920	missense	possibly damaging	0.50
IGL02321:Axl	APN	7	25758769	missense	probably damaging	1.00
IGL02839:Axl	APN	7	25766791	critical splice donor site	probably null
IGL02878:Axl	APN	7	25758877	missense	probably damaging	0.99
R0125:Axl	UTSW	7	25786943	missense	probably benign	0.00
R0529:Axl	UTSW	7	25787287	splice site	probably benign
R0539:Axl	UTSW	7	25778717	unclassified	probably benign
R0614:Axl	UTSW	7	25774163	missense	probably benign	0.18
R0747:Axl	UTSW	7	25764059	missense	possibly damaging	0.95
R1599:Axl	UTSW	7	25763969	missense	probably damaging	0.99
R1727:Axl	UTSW	7	25760766	missense	possibly damaging	0.68
R1880:Axl	UTSW	7	25774548	missense	probably damaging	1.00
R2206:Axl	UTSW	7	25770636	missense	probably damaging	1.00
R2513:Axl	UTSW	7	25787516	missense	probably benign
R2877:Axl	UTSW	7	25766524	missense	probably damaging	0.96
R3802:Axl	UTSW	7	25788477	start codon destroyed	probably null	0.98
R3915:Axl	UTSW	7	25760744	splice site	probably benign
R4064:Axl	UTSW	7	25764020	missense	probably benign	0.36
R4072:Axl	UTSW	7	25763911	unclassified	probably benign
R4073:Axl	UTSW	7	25763911	unclassified	probably benign
R4378:Axl	UTSW	7	25758837	missense	probably benign	0.06
R5039:Axl	UTSW	7	25785915	missense	probably damaging	1.00
R5224:Axl	UTSW	7	25786944	missense	probably benign	0.00
R5328:Axl	UTSW	7	25773411	missense	probably damaging	1.00
R5519:Axl	UTSW	7	25778662	missense	possibly damaging	0.93
R5885:Axl	UTSW	7	25766852	missense	probably damaging	1.00
R6367:Axl	UTSW	7	25787433	missense	probably damaging	1.00
R6447:Axl	UTSW	7	25770283	missense	probably damaging	0.96
R6931:Axl	UTSW	7	25761433	missense	probably damaging	1.00
R7172:Axl	UTSW	7	25786974	missense	probably benign	0.33
R7355:Axl	UTSW	7	25774106	missense	probably benign	0.22
R7410:Axl	UTSW	7	25758783	missense	probably benign	0.06
R8274:Axl	UTSW	7	25764013	missense	probably damaging	0.99
R8279:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8281:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8282:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8283:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8546:Axl	UTSW	7	25774163	missense	probably benign	0.00
R8742:Axl	UTSW	7	25764436	missense	probably damaging	0.99
R9002:Axl	UTSW	7	25778678	missense	probably damaging	0.97
R9139:Axl	UTSW	7	25761421	missense	probably damaging	1.00
R9179:Axl	UTSW	7	25770233	missense	probably damaging	0.97
R9324:Axl	UTSW	7	25761557	missense	probably damaging	1.00
R9343:Axl	UTSW	7	25774119	missense	probably damaging	1.00
R9352:Axl	UTSW	7	25763327	missense	possibly damaging	0.73
X0027:Axl	UTSW	7	25770268	missense	probably damaging	1.00
Z1177:Axl	UTSW	7	25761526	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCACCCTTTCAGTCAGG -3'
(R):5'- ATAACTGATCTTCCTGGGGTGG -3'

Sequencing Primer
(F):5'- ATTAATTCCAAGGCCACCTTATCG -3'
(R):5'- GGGGGCTCAGGCGTCTG -3'

Posted On

2015-05-15