Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Olfr670'

316469

Institutional Source

Beutler Lab

Gene Symbol

Olfr670

Ensembl Gene

ENSMUSG00000044705

Gene Name

olfactory receptor 670

Synonyms

MOR32-8, GA_x6K02T2PBJ9-7589577-7588639

MMRRC Submission

040855-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104957114-104962620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104960716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 5 (N5K)

Ref Sequence

ENSEMBL: ENSMUSP00000151138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]

AlphaFold

Q7TRP3

Predicted Effect

probably damaging
Transcript: ENSMUST00000050482
AA Change: N5K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: N5K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	311	3.7e-121	PFAM
Pfam:7TM_GPCR_Srsx	37	211	4.5e-7	PFAM
Pfam:7tm_1	43	293	3.9e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214216
AA Change: N5K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Lrig3	C	T	10: 126,013,408	T999I	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Nup205	T	A	6: 35,192,040		probably null	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Vmn2r24	A	T	6: 123,787,415	H417L	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Olfr670

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Olfr670	APN	7	104960716	missense	probably damaging	0.96
IGL01100:Olfr670	APN	7	104959995	missense	probably benign	0.07
IGL01351:Olfr670	APN	7	104960739	start gained	probably benign
IGL01478:Olfr670	APN	7	104960348	missense	probably damaging	0.97
IGL01835:Olfr670	APN	7	104960462	missense	probably benign	0.01
IGL02326:Olfr670	APN	7	104960646	missense	probably benign	0.12
IGL02434:Olfr670	APN	7	104960072	missense	probably benign	0.05
IGL02434:Olfr670	APN	7	104960074	nonsense	probably null
IGL02968:Olfr670	APN	7	104960244	missense	possibly damaging	0.90
R0055:Olfr670	UTSW	7	104960496	missense	possibly damaging	0.46
R0055:Olfr670	UTSW	7	104960496	missense	possibly damaging	0.46
R0345:Olfr670	UTSW	7	104960181	missense	probably damaging	1.00
R0401:Olfr670	UTSW	7	104959943	missense	probably damaging	1.00
R0646:Olfr670	UTSW	7	104959811	missense	probably benign	0.02
R1493:Olfr670	UTSW	7	104960502	missense	probably damaging	0.97
R1532:Olfr670	UTSW	7	104960265	missense	probably benign
R1557:Olfr670	UTSW	7	104960540	missense	probably damaging	0.99
R4072:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4075:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4076:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4229:Olfr670	UTSW	7	104960594	missense	probably benign	0.18
R4230:Olfr670	UTSW	7	104960594	missense	probably benign	0.18
R5374:Olfr670	UTSW	7	104959996	missense	probably damaging	1.00
R6006:Olfr670	UTSW	7	104960663	missense	probably damaging	0.99
R6891:Olfr670	UTSW	7	104959985	missense	probably damaging	1.00
R7465:Olfr670	UTSW	7	104959917	missense	probably benign	0.23
R8105:Olfr670	UTSW	7	104960422	missense	probably benign	0.15
R8117:Olfr670	UTSW	7	104960149	missense	probably damaging	1.00
R8356:Olfr670	UTSW	7	104960727	missense	probably benign	0.00
R8510:Olfr670	UTSW	7	104960114	nonsense	probably null
R9145:Olfr670	UTSW	7	104959997	missense	probably damaging	1.00
R9168:Olfr670	UTSW	7	104959794	makesense	probably null
R9234:Olfr670	UTSW	7	104960444	missense	probably damaging	1.00
R9706:Olfr670	UTSW	7	104959988	missense	probably damaging	0.99
R9789:Olfr670	UTSW	7	104960450	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACATGGGTTGATGAAGACTGTG -3'
(R):5'- CTGAGGAACTGCAGCTTATCTAG -3'

Sequencing Primer
(F):5'- GAAGACTGTGTTCACTCTTGATCAC -3'
(R):5'- GAGCATTTGACTAGCACATGC -3'

Posted On

2015-05-15