Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Lrig3'

316477

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

040855-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 126013408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 999 (T999I)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000074807
AA Change: T999I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: T999I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219974

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Nup205	T	A	6: 35,192,040		probably null	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Vmn2r24	A	T	6: 123,787,415	H417L	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAACTTGAAAAGGTTGCAGCTC -3'
(R):5'- CACCCAAGTGTATTTCAGAAGCG -3'

Sequencing Primer
(F):5'- CTTGAAAAGGTTGCAGCTCTGACC -3'
(R):5'- GGATTTAGAACTCACAGGATCTCACG -3'

Posted On

2015-05-15