Incidental Mutation 'R4074:Krtap31-1'
ID 316478
Institutional Source Beutler Lab
Gene Symbol Krtap31-1
Ensembl Gene ENSMUSG00000070334
Gene Name keratin associated protein 31-1
Synonyms 4733401H21Rik
MMRRC Submission 040855-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R4074 (G1)
Quality Score 132
Status Validated
Chromosome 11
Chromosomal Location 99798746-99799716 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99799058 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 87 (I87T)
Ref Sequence ENSEMBL: ENSMUSP00000091467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093935]
AlphaFold Q9D644
Predicted Effect possibly damaging
Transcript: ENSMUST00000093935
AA Change: I87T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091467
Gene: ENSMUSG00000070334
AA Change: I87T

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 40 56 N/A INTRINSIC
Pfam:Keratin_B2_2 64 107 1.9e-9 PFAM
Pfam:Keratin_B2_2 111 157 2.4e-6 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,485,401 (GRCm39) E422G probably damaging Het
Ace3 A G 11: 105,888,040 (GRCm39) Y287C probably damaging Het
Adam34l A T 8: 44,079,387 (GRCm39) F279Y probably damaging Het
Albfm1 T A 5: 90,740,727 (GRCm39) probably null Het
Arfgap3 C T 15: 83,187,330 (GRCm39) A510T probably damaging Het
Atg12 A G 18: 46,870,491 (GRCm39) F92L probably benign Het
Axl A G 7: 25,463,336 (GRCm39) probably benign Het
Chgb C A 2: 132,635,847 (GRCm39) D596E possibly damaging Het
Cmtr2 T A 8: 110,947,849 (GRCm39) F53Y possibly damaging Het
Cnot10 A G 9: 114,452,015 (GRCm39) F254L possibly damaging Het
Crb2 G T 2: 37,676,855 (GRCm39) C251F probably damaging Het
Crybg3 A T 16: 59,376,120 (GRCm39) probably benign Het
Cytl1 A G 5: 37,892,940 (GRCm39) I17V unknown Het
D930020B18Rik A G 10: 121,492,123 (GRCm39) probably benign Het
Depp1 A G 6: 116,629,029 (GRCm39) N124S possibly damaging Het
Dnah11 A G 12: 118,009,413 (GRCm39) M2083T probably benign Het
Dst A G 1: 34,231,350 (GRCm39) E2656G probably benign Het
Dst T C 1: 34,267,542 (GRCm39) F4995L probably damaging Het
Egf C T 3: 129,529,618 (GRCm39) R264Q probably benign Het
Eps15l1 A G 8: 73,134,128 (GRCm39) I482T probably damaging Het
Eqtn A G 4: 94,808,199 (GRCm39) I201T possibly damaging Het
Ero1a A T 14: 45,529,893 (GRCm39) probably null Het
Etl4 T C 2: 20,814,030 (GRCm39) probably benign Het
Fcho1 T C 8: 72,163,013 (GRCm39) H672R probably damaging Het
Glt6d1 T C 2: 25,684,139 (GRCm39) D289G probably damaging Het
Gm5134 T A 10: 75,844,365 (GRCm39) W574R probably damaging Het
Gm5414 T C 15: 101,533,988 (GRCm39) N332D probably benign Het
Gnb3 T A 6: 124,813,942 (GRCm39) E215D probably benign Het
Ighv1-30 C T 12: 114,781,021 (GRCm39) noncoding transcript Het
Ighv1-4 A G 12: 114,451,147 (GRCm39) S15P possibly damaging Het
Igkv1-133 T G 6: 67,702,505 (GRCm39) Y74* probably null Het
Il17f G A 1: 20,847,987 (GRCm39) probably benign Het
Itpr2 C T 6: 146,274,742 (GRCm39) probably null Het
Lilra6 A T 7: 3,917,889 (GRCm39) F85Y probably benign Het
Lrig3 C T 10: 125,849,277 (GRCm39) T999I probably benign Het
Myh7b T C 2: 155,460,678 (GRCm39) I277T probably damaging Het
Myo3b T C 2: 70,119,808 (GRCm39) F984S probably damaging Het
Naip5 G A 13: 100,382,572 (GRCm39) R46W probably damaging Het
Nup205 T A 6: 35,168,975 (GRCm39) probably null Het
Or52e18 A T 7: 104,609,923 (GRCm39) N5K probably damaging Het
Pde11a C T 2: 76,168,242 (GRCm39) R237H probably damaging Het
Pdk4 T C 6: 5,491,865 (GRCm39) N69S probably benign Het
Pot1a T C 6: 25,752,356 (GRCm39) probably null Het
Pramel33 A T 5: 93,633,057 (GRCm39) M50K probably damaging Het
Psg23 A T 7: 18,341,043 (GRCm39) S404T possibly damaging Het
Rev1 T G 1: 38,093,319 (GRCm39) K1075T possibly damaging Het
Rrbp1 T G 2: 143,805,030 (GRCm39) Q1045P probably benign Het
Scg2 A C 1: 79,414,574 (GRCm39) F50V probably damaging Het
Sel1l3 A G 5: 53,311,629 (GRCm39) Y619H probably damaging Het
Slco1a5 A T 6: 142,213,950 (GRCm39) I57K possibly damaging Het
Srp72 C A 5: 77,146,098 (GRCm39) T633K probably benign Het
Swt1 A G 1: 151,270,520 (GRCm39) V565A probably benign Het
Tesk1 A G 4: 43,443,606 (GRCm39) I58V possibly damaging Het
Tm2d3 T A 7: 65,347,498 (GRCm39) L49* probably null Het
Tmprss11e T C 5: 86,863,502 (GRCm39) T188A possibly damaging Het
Tnxb A G 17: 34,890,845 (GRCm39) N396S probably benign Het
Tuba8 T A 6: 121,199,756 (GRCm39) S147T probably damaging Het
Usp8 A G 2: 126,594,290 (GRCm39) D822G probably damaging Het
Vmn2r13 T A 5: 109,304,566 (GRCm39) I622F probably damaging Het
Vmn2r24 A T 6: 123,764,374 (GRCm39) H417L possibly damaging Het
Zfp608 A T 18: 55,031,180 (GRCm39) V920E probably damaging Het
Zmym2 T C 14: 57,140,461 (GRCm39) L100P probably damaging Het
Other mutations in Krtap31-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1608:Krtap31-1 UTSW 11 99,798,919 (GRCm39) missense probably benign 0.18
R2284:Krtap31-1 UTSW 11 99,799,081 (GRCm39) nonsense probably null
R2343:Krtap31-1 UTSW 11 99,798,847 (GRCm39) missense possibly damaging 0.86
R4072:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4076:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4086:Krtap31-1 UTSW 11 99,799,145 (GRCm39) missense possibly damaging 0.93
R4884:Krtap31-1 UTSW 11 99,799,310 (GRCm39) missense unknown
R7644:Krtap31-1 UTSW 11 99,799,048 (GRCm39) missense possibly damaging 0.71
R7670:Krtap31-1 UTSW 11 99,799,258 (GRCm39) missense not run
R7897:Krtap31-1 UTSW 11 99,798,949 (GRCm39) missense possibly damaging 0.73
R7949:Krtap31-1 UTSW 11 99,799,144 (GRCm39) missense possibly damaging 0.71
R8158:Krtap31-1 UTSW 11 99,798,901 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AATCCAGCTCTGAATCCAGC -3'
(R):5'- CTGGTTATCAGCGGCAGATG -3'

Sequencing Primer
(F):5'- TGAATCCAGCTGCCCTGTG -3'
(R):5'- TATCAGCGGCAGATGGGCAC -3'
Posted On 2015-05-15