Incidental Mutation 'R4075:Gm14085'
ID316499
Institutional Source Beutler Lab
Gene Symbol Gm14085
Ensembl Gene ENSMUSG00000079071
Gene Namepredicted gene 14085
Synonyms
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122484941-122528040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122514411 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 166 (V166G)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
Predicted Effect probably benign
Transcript: ENSMUST00000110521
AA Change: V166G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: V166G

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Gm14085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Gm14085 APN 2 122517046 missense probably damaging 0.98
IGL01160:Gm14085 APN 2 122524796 critical splice acceptor site probably null
IGL01838:Gm14085 APN 2 122517983 missense possibly damaging 0.65
IGL01895:Gm14085 APN 2 122525091 missense possibly damaging 0.75
IGL02999:Gm14085 APN 2 122514514 splice site probably benign
K2124:Gm14085 UTSW 2 122525153 missense probably benign 0.00
R0084:Gm14085 UTSW 2 122522833 missense possibly damaging 0.95
R0092:Gm14085 UTSW 2 122517597 splice site probably benign
R0127:Gm14085 UTSW 2 122517069 critical splice donor site probably null
R0200:Gm14085 UTSW 2 122527447 makesense probably null
R0276:Gm14085 UTSW 2 122521928 missense probably damaging 1.00
R0309:Gm14085 UTSW 2 122517553 missense probably benign 0.04
R0403:Gm14085 UTSW 2 122521854 missense probably damaging 1.00
R0600:Gm14085 UTSW 2 122514398 missense probably damaging 0.97
R0612:Gm14085 UTSW 2 122521698 missense probably damaging 1.00
R1676:Gm14085 UTSW 2 122521859 missense probably damaging 0.99
R1801:Gm14085 UTSW 2 122521652 missense possibly damaging 0.57
R1986:Gm14085 UTSW 2 122527429 missense probably benign 0.00
R2050:Gm14085 UTSW 2 122522868 missense probably benign 0.21
R3078:Gm14085 UTSW 2 122514414 missense possibly damaging 0.63
R4096:Gm14085 UTSW 2 122522728 missense probably damaging 1.00
R4744:Gm14085 UTSW 2 122522805 nonsense probably null
R4796:Gm14085 UTSW 2 122514459 missense probably damaging 0.99
R5033:Gm14085 UTSW 2 122522914 critical splice donor site probably null
R5069:Gm14085 UTSW 2 122494373 missense possibly damaging 0.93
R5288:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5385:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5386:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5442:Gm14085 UTSW 2 122486869 missense probably benign
R5795:Gm14085 UTSW 2 122517994 missense possibly damaging 0.79
R6258:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6260:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6383:Gm14085 UTSW 2 122524807 missense probably benign 0.00
R7226:Gm14085 UTSW 2 122522532 missense probably benign 0.00
R7574:Gm14085 UTSW 2 122522844 missense not run
R7633:Gm14085 UTSW 2 122486680 missense probably null 0.05
R7705:Gm14085 UTSW 2 122521629 critical splice acceptor site probably null
R7726:Gm14085 UTSW 2 122486733 missense probably damaging 0.99
R7998:Gm14085 UTSW 2 122494358 missense probably damaging 0.97
R8269:Gm14085 UTSW 2 122521688 missense probably damaging 1.00
R8337:Gm14085 UTSW 2 122525136 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCAGATCATTCTCAAGGTTCCTC -3'
(R):5'- TGTCAGGAGAAGATTCCGGG -3'

Sequencing Primer
(F):5'- GTTCCTCTCTGTGTAATGAATAAGCC -3'
(R):5'- TGAGTACCTGACATGGGCACTTTAC -3'
Posted On2015-05-15