Incidental Mutation 'R4075:Nxt1'
ID316500
Institutional Source Beutler Lab
Gene Symbol Nxt1
Ensembl Gene ENSMUSG00000036992
Gene NameNTF2-related export protein 1
Synonyms
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148672601-148676027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148675732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000105587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047177] [ENSMUST00000109961]
Predicted Effect probably damaging
Transcript: ENSMUST00000047177
AA Change: D131G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038329
Gene: ENSMUSG00000036992
AA Change: D131G

DomainStartEndE-ValueType
Pfam:NTF2 16 135 2.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109961
AA Change: D131G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105587
Gene: ENSMUSG00000036992
AA Change: D131G

DomainStartEndE-ValueType
Pfam:NTF2 16 135 1e-30 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the nuclear envelope. It has protein similarity to nuclear transport factor 2. This protein functions as a nuclear export factor in both RAN (Ras-related nuclear protein)- and CRM1 (required for chromosome region maintenance)-dependent pathways. It is found to stimulate the export of U1 snRNA in RAN- and CRM1-dependent pathways and the export of tRNA and mRNA in a CRM1-independent pathway. The encoded protein heterodimerizes with Tap protein and may regulate the ability of Tap protein to mediate nuclear mRNA export. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Nxt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Nxt1 APN 2 148675396 missense probably damaging 0.97
IGL02103:Nxt1 APN 2 148675644 nonsense probably null
IGL02958:Nxt1 APN 2 148675772 utr 3 prime probably benign
R0139:Nxt1 UTSW 2 148675470 missense probably benign 0.01
R3605:Nxt1 UTSW 2 148675479 missense probably damaging 1.00
R4235:Nxt1 UTSW 2 148675347 missense probably benign 0.28
R5685:Nxt1 UTSW 2 148675753 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGTTTCAGGACAAGAATCC -3'
(R):5'- GATTCTGGGAGTCCAACATCC -3'

Sequencing Primer
(F):5'- TTCCAAATCAGCGTGGTAGACTG -3'
(R):5'- AACATCCAGTCTGCAGTGCTG -3'
Posted On2015-05-15