Incidental Mutation 'R4075:Hormad1'
ID316506
Institutional Source Beutler Lab
Gene Symbol Hormad1
Ensembl Gene ENSMUSG00000028109
Gene NameHORMA domain containing 1
SynonymsNohma, 4921522K05Rik
MMRRC Submission 040974-MU
Accession Numbers

Genbank: NM_026489.2; Ensembl: ENSMUST00000107154, ENSMUST00000090797, ENSMUST00000029754, ENSMUST00000171191

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95559677-95587671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95578203 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 234 (M234T)
Ref Sequence ENSEMBL: ENSMUSP00000127180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029754] [ENSMUST00000090797] [ENSMUST00000107154] [ENSMUST00000171191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029754
AA Change: M234T

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029754
Gene: ENSMUSG00000028109
AA Change: M234T

DomainStartEndE-ValueType
Pfam:HORMA 24 221 4.7e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090797
AA Change: M234T

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088303
Gene: ENSMUSG00000028109
AA Change: M234T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107154
AA Change: M234T

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102772
Gene: ENSMUSG00000028109
AA Change: M234T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171191
AA Change: M234T

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127180
Gene: ENSMUSG00000028109
AA Change: M234T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozgous mice are infertile because of meiosis arrest associated with impaired synaptonemal-complex formation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Hormad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Hormad1 APN 3 95578297 missense possibly damaging 0.49
IGL01686:Hormad1 APN 3 95578269 missense probably benign 0.02
IGL02023:Hormad1 APN 3 95578293 missense possibly damaging 0.91
B6584:Hormad1 UTSW 3 95570696 splice site probably benign
R0025:Hormad1 UTSW 3 95585125 unclassified probably benign
R0662:Hormad1 UTSW 3 95575599 missense probably benign 0.01
R0704:Hormad1 UTSW 3 95566686 critical splice donor site probably null
R1854:Hormad1 UTSW 3 95580006 missense probably benign 0.08
R2199:Hormad1 UTSW 3 95567722 critical splice donor site probably null
R2371:Hormad1 UTSW 3 95575599 missense probably benign 0.18
R2411:Hormad1 UTSW 3 95580015 missense probably benign 0.41
R3522:Hormad1 UTSW 3 95576285 missense probably benign 0.01
R4202:Hormad1 UTSW 3 95585198 missense probably benign 0.00
R4535:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4536:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4844:Hormad1 UTSW 3 95570931 missense probably damaging 0.98
R4903:Hormad1 UTSW 3 95585220 splice site probably null
R4964:Hormad1 UTSW 3 95585220 splice site probably null
R5135:Hormad1 UTSW 3 95585220 unclassified probably benign
R5208:Hormad1 UTSW 3 95578107 missense possibly damaging 0.46
R5372:Hormad1 UTSW 3 95576424 missense probably damaging 1.00
R5825:Hormad1 UTSW 3 95562559 missense probably damaging 0.97
R5895:Hormad1 UTSW 3 95559733 critical splice donor site probably null
R6124:Hormad1 UTSW 3 95576302 missense probably benign
R6453:Hormad1 UTSW 3 95578257 missense probably benign 0.02
R7308:Hormad1 UTSW 3 95562555 missense probably damaging 0.99
R7373:Hormad1 UTSW 3 95576317 missense probably damaging 1.00
X0025:Hormad1 UTSW 3 95581567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGAGCATCTCTATATTTCAGC -3'
(R):5'- CGGCCAGCCATTTGATTCAG -3'

Sequencing Primer
(F):5'- GGAGCATCTCTATATTTCAGCTTAGG -3'
(R):5'- ACCAATGTTTGCTACTACTG -3'
Posted On2015-05-15