Incidental Mutation 'R4075:Ifi44'
ID316508
Institutional Source Beutler Lab
Gene Symbol Ifi44
Ensembl Gene ENSMUSG00000028037
Gene Nameinterferon-induced protein 44
SynonymsA430056A10Rik, p44, MTAP44
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location151730922-151749960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151745976 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 164 (N164K)
Ref Sequence ENSEMBL: ENSMUSP00000029671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029671]
Predicted Effect probably benign
Transcript: ENSMUST00000029671
AA Change: N164K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029671
Gene: ENSMUSG00000028037
AA Change: N164K

DomainStartEndE-ValueType
Pfam:TLD 26 147 2.8e-7 PFAM
low complexity region 193 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149919
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Ifi44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ifi44 APN 3 151749580 missense probably benign 0.03
IGL01477:Ifi44 APN 3 151745998 splice site probably benign
IGL01571:Ifi44 APN 3 151745537 missense probably damaging 0.97
IGL02165:Ifi44 APN 3 151749430 missense probably damaging 1.00
IGL02238:Ifi44 APN 3 151732382 makesense probably null
IGL02609:Ifi44 APN 3 151732497 missense probably damaging 1.00
IGL02650:Ifi44 APN 3 151745855 missense probably damaging 1.00
IGL02726:Ifi44 APN 3 151749596 start gained probably benign
IGL02977:Ifi44 APN 3 151739379 missense probably benign 0.00
R0201:Ifi44 UTSW 3 151745636 missense probably damaging 1.00
R0454:Ifi44 UTSW 3 151745497 missense possibly damaging 0.78
R0763:Ifi44 UTSW 3 151749498 missense probably damaging 1.00
R1640:Ifi44 UTSW 3 151732534 missense probably benign 0.00
R1747:Ifi44 UTSW 3 151749285 missense probably benign 0.00
R2278:Ifi44 UTSW 3 151732388 missense probably benign
R3816:Ifi44 UTSW 3 151749257 missense possibly damaging 0.92
R4084:Ifi44 UTSW 3 151745489 critical splice donor site probably null
R4782:Ifi44 UTSW 3 151745592 missense probably damaging 0.99
R5071:Ifi44 UTSW 3 151749632 start gained probably benign
R5074:Ifi44 UTSW 3 151749632 start gained probably benign
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6128:Ifi44 UTSW 3 151749186 missense probably benign 0.00
R6192:Ifi44 UTSW 3 151745639 critical splice acceptor site probably null
R6434:Ifi44 UTSW 3 151749189 missense probably benign 0.02
R6536:Ifi44 UTSW 3 151732489 missense probably benign 0.03
R6902:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R6946:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R7346:Ifi44 UTSW 3 151732457 missense probably benign
R7608:Ifi44 UTSW 3 151732408 missense probably damaging 0.97
R7704:Ifi44 UTSW 3 151732424 missense probably benign 0.44
R8255:Ifi44 UTSW 3 151745982 missense probably benign 0.00
Z1176:Ifi44 UTSW 3 151732453 missense probably damaging 1.00
Z1177:Ifi44 UTSW 3 151749438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATTCCATCTTCATCACAGCC -3'
(R):5'- CTTCACCTTTGGCATGACTAATATC -3'

Sequencing Primer
(F):5'- TTCATCACAGCCCACCAAGATCTG -3'
(R):5'- GGCAAGGTTTCACTTCCTAAAGGC -3'
Posted On2015-05-15