Incidental Mutation 'R4075:Il17rc'
ID316512
Institutional Source Beutler Lab
Gene Symbol Il17rc
Ensembl Gene ENSMUSG00000030281
Gene Nameinterleukin 17 receptor C
Synonyms1110025H02Rik, IL17-RL, Il17rl
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113471427-113483140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113481197 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 327 (D327G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000058300]
Predicted Effect probably benign
Transcript: ENSMUST00000032422
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058300
AA Change: D423G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281
AA Change: D423G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147932
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203668
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect probably benign
Transcript: ENSMUST00000204632
Predicted Effect possibly damaging
Transcript: ENSMUST00000205208
AA Change: D327G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit increased interleukin-17 secretion, reduced chemokine expression, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Il17rc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Il17rc APN 6 113474171 missense probably damaging 0.96
IGL03192:Il17rc APN 6 113472885 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R1462:Il17rc UTSW 6 113478989 missense probably damaging 1.00
R5025:Il17rc UTSW 6 113472366 missense possibly damaging 0.62
R5052:Il17rc UTSW 6 113472323 missense probably damaging 1.00
R5148:Il17rc UTSW 6 113482997 missense probably benign 0.19
R5302:Il17rc UTSW 6 113483036 missense possibly damaging 0.71
R5977:Il17rc UTSW 6 113482731 missense probably damaging 0.98
R6275:Il17rc UTSW 6 113480347 missense probably benign 0.00
R7010:Il17rc UTSW 6 113479288 missense possibly damaging 0.86
R8031:Il17rc UTSW 6 113482821 missense probably damaging 1.00
R8138:Il17rc UTSW 6 113482539 missense probably damaging 1.00
R8160:Il17rc UTSW 6 113476528 missense possibly damaging 0.94
R8209:Il17rc UTSW 6 113472810 missense probably benign 0.01
Z1176:Il17rc UTSW 6 113476795 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTGCTAGGTTCTAGAAAGAGC -3'
(R):5'- TTTGACTGGTTGAAAGGAATGC -3'

Sequencing Primer
(F):5'- CATTTGGCACAGAGGTCAGC -3'
(R):5'- TTGAAAGGAATGCTGCTGTGAC -3'
Posted On2015-05-15