Incidental Mutation 'R4075:Olfr1350'
ID316517
Institutional Source Beutler Lab
Gene Symbol Olfr1350
Ensembl Gene ENSMUSG00000056696
Gene Nameolfactory receptor 1350
SynonymsGA_x6K02T2QGBW-3300391-3301317, MOR222-3
MMRRC Submission 040974-MU
Accession Numbers

Genbank: NM_146389.1

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6564841-6571401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6570143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 51 (S51P)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
Predicted Effect probably benign
Transcript: ENSMUST00000070985
AA Change: S51P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: S51P

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207221
AA Change: S51P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000219278
AA Change: S51P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Olfr1350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr1350 APN 7 6570668 missense possibly damaging 0.88
IGL01387:Olfr1350 APN 7 6570855 missense probably damaging 1.00
IGL01457:Olfr1350 APN 7 6570212 missense probably benign 0.12
IGL01568:Olfr1350 APN 7 6570570 missense possibly damaging 0.91
I2288:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
I2289:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
R0454:Olfr1350 UTSW 7 6570360 missense probably damaging 1.00
R0558:Olfr1350 UTSW 7 6570653 missense possibly damaging 0.77
R1103:Olfr1350 UTSW 7 6570112 missense probably damaging 1.00
R1352:Olfr1350 UTSW 7 6570783 missense probably benign 0.11
R1503:Olfr1350 UTSW 7 6570471 missense probably damaging 1.00
R1630:Olfr1350 UTSW 7 6570674 missense probably damaging 1.00
R1981:Olfr1350 UTSW 7 6570558 missense probably benign 0.01
R2228:Olfr1350 UTSW 7 6570803 missense probably benign
R2258:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2259:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2260:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R4750:Olfr1350 UTSW 7 6570851 missense probably benign 0.34
R4917:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R4918:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R5571:Olfr1350 UTSW 7 6570825 missense possibly damaging 0.95
R5915:Olfr1350 UTSW 7 6570173 missense probably benign 0.31
R6969:Olfr1350 UTSW 7 6570321 missense probably damaging 1.00
R7061:Olfr1350 UTSW 7 6570783 missense probably damaging 1.00
R7286:Olfr1350 UTSW 7 6570716 missense probably damaging 1.00
R7510:Olfr1350 UTSW 7 6569961 start gained probably benign
V1662:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
Z1176:Olfr1350 UTSW 7 6570048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCGTAGGTCCTTGCTATG -3'
(R):5'- ATTCCAGAGAGCCAAAGCAG -3'

Sequencing Primer
(F):5'- ATGGTTGCTGATTCTCTTCATGC -3'
(R):5'- CAGACAAAAGCAAAGAGTTGAGATGC -3'
Posted On2015-05-15