Incidental Mutation 'R4075:Obox3'
ID316519
Institutional Source Beutler Lab
Gene Symbol Obox3
Ensembl Gene ENSMUSG00000066772
Gene Nameoocyte specific homeobox 3
Synonyms
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4075 (G1)
Quality Score211
Status Not validated
Chromosome7
Chromosomal Location15479825-15639902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15625799 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 315 (T315N)
Ref Sequence ENSEMBL: ENSMUSP00000134531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086122] [ENSMUST00000095217] [ENSMUST00000173395] [ENSMUST00000173912] [ENSMUST00000174151] [ENSMUST00000174443] [ENSMUST00000174842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086122
AA Change: T315N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083291
Gene: ENSMUSG00000066772
AA Change: T315N

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095217
AA Change: T315N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092842
Gene: ENSMUSG00000066772
AA Change: T315N

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173395
SMART Domains Protein: ENSMUSP00000133788
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173912
AA Change: T315N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133427
Gene: ENSMUSG00000066772
AA Change: T315N

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174151
SMART Domains Protein: ENSMUSP00000133814
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174443
AA Change: T315N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134531
Gene: ENSMUSG00000066772
AA Change: T315N

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174842
SMART Domains Protein: ENSMUSP00000134526
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 151 1.46e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182148
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Obox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Obox3 APN 7 15626852 missense probably benign 0.00
IGL02601:Obox3 APN 7 15626923 missense probably damaging 0.99
IGL02978:Obox3 APN 7 15626253 missense probably benign 0.11
IGL03088:Obox3 APN 7 15627002 splice site probably benign
IGL03178:Obox3 APN 7 15627277 missense probably benign 0.12
IGL03219:Obox3 APN 7 15625878 missense probably damaging 0.99
IGL03373:Obox3 APN 7 15625790 missense probably benign 0.01
R0119:Obox3 UTSW 7 15626327 critical splice acceptor site probably null
R1471:Obox3 UTSW 7 15626950 missense probably benign 0.01
R3916:Obox3 UTSW 7 15627226 missense probably benign 0.00
R4072:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4073:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4076:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4712:Obox3 UTSW 7 15626839 missense probably benign 0.04
R4751:Obox3 UTSW 7 15625692 critical splice donor site probably null
R4868:Obox3 UTSW 7 15627310 missense probably damaging 1.00
R5151:Obox3 UTSW 7 15626248 missense probably damaging 1.00
R5290:Obox3 UTSW 7 15626849 missense probably benign 0.03
R5399:Obox3 UTSW 7 15626288 missense probably benign 0.00
R5882:Obox3 UTSW 7 15626968 missense probably benign 0.17
R6147:Obox3 UTSW 7 15626001 missense probably damaging 0.99
R6378:Obox3 UTSW 7 15626102 missense probably benign 0.00
R7221:Obox3 UTSW 7 15626058 missense probably benign 0.01
R7314:Obox3 UTSW 7 15627154 missense possibly damaging 0.50
R8124:Obox3 UTSW 7 15589949 splice site probably null
Z1176:Obox3 UTSW 7 15626224 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCGAATTATGTGCTCTCAAAGTG -3'
(R):5'- TCTCAAACTGACTTAGCAGTAGC -3'

Sequencing Primer
(F):5'- AACTTTATCTGCCTCAGTACAGGGG -3'
(R):5'- GCAGTAGCTGAAGTTCCAGTC -3'
Posted On2015-05-15