Incidental Mutation 'R4075:Acsm4'
ID316523
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Nameacyl-CoA synthetase medium-chain family member 4
SynonymsOMACS, O-MACS
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119690026-119714565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119698758 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 206 (L206H)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
Predicted Effect probably benign
Transcript: ENSMUST00000047045
AA Change: L206H

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: L206H

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119711419 nonsense probably null
IGL01676:Acsm4 APN 7 119708643 missense probably benign 0.00
IGL01801:Acsm4 APN 7 119707263 missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119693852 splice site probably null
IGL02220:Acsm4 APN 7 119711172 missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119710684 missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119703423 splice site probably benign
I0000:Acsm4 UTSW 7 119711192 missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119698575 missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119708710 missense probably benign 0.00
R1386:Acsm4 UTSW 7 119698578 missense probably benign
R1433:Acsm4 UTSW 7 119693819 missense probably damaging 0.99
R1961:Acsm4 UTSW 7 119708740 missense probably benign 0.04
R3957:Acsm4 UTSW 7 119703365 missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119693785 missense probably benign
R4072:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4076:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4432:Acsm4 UTSW 7 119711387 missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119698574 missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119698677 missense probably benign
R4992:Acsm4 UTSW 7 119711417 missense probably benign 0.43
R5046:Acsm4 UTSW 7 119703374 missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119712950 missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119694800 missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119693845 missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119711399 missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119693710 missense probably benign 0.01
R7892:Acsm4 UTSW 7 119694666 missense possibly damaging 0.48
Z1177:Acsm4 UTSW 7 119711371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACGATCCAACTGACCAG -3'
(R):5'- TCATCATAGGCCACAGAGGAG -3'

Sequencing Primer
(F):5'- GAAAAGACATCCTCTACCGGCTG -3'
(R):5'- CAGAGGACATATGTTCAATCCCTGG -3'
Posted On2015-05-15